75
Hibridos resistentes para la production sostenible del tomate. Dr. Luis Mejia, Facultad de Agronomia, USAC. enero, 2006
Hibridos resistentes para la production sostenible del tomate.
Dr. Luis Mejia, Facultad de Agronomia, USAC. enero, 2006
Forldo Competitivo de Desarrollo Tecnologico Agroalimerltario AGROCYT
H~BRIDOS RESISTENTES A VIROSIS TRANSMITIDA POR MOSCA BLANCA Y A OTROS ~ A T O G E N O S DE ~MPORTANCIA ECONOMICA
PARA LA PRODUCCION SOSTENIBLE DEL TOMATE EN GUATEMALA
AGROCM 002-2002
Septiembre 2003 - diciembre 2005
INFORME FINAL
Dr. Luis Mejia Facultad de Agrolioniia, Univefiidad de San Carlos
Guatemala, enero 2006
INTIXODUCC:ION ....................................................................................................................... 3 ........................................................................... La enf'ennedacl del aco1ocharnienr.o de ia hoja 3 . .
Geminiv~.rus tran:..nitido.; por rnosca blanca ................................................................................ 3 ................................................................................................................... La mo.sca blanca 5
La Urlidad de Riego San.;irisq ................................................................................................. 6 Re:sis~:encia genktica a gemii~ivirus transmitidos por mosca blanca ........................................... 6 Hibridos Resis tentes .................................................................................................................... 8
........................................................................................................................... Cultiva:~ 8 ......................................................................................... 0:rigen y otras ciu.acteri.stic.as 8
OBJETI'VOS ................................................................................................................................ 10 Ob. jetivo general ........................................................................................................................ 10 0b.jetivos especificos .............................................................................................................. 1 1
MATERL4L)ES Y METOI)OS ............................................................................. ..................... 1 1 COMI'OFJEI\TTE 1 : -Eva.l1~aci61.1 y seleccion dc lineas resistentes ............................................ I 1 COMT-'ONENTE 2 : Proclucc16n y evaluacicn d s tLibridos r:sistentes o tolcrantes ................. 1 . 3
RESULTID OS ............................................................................................................................ 113 EvzLluacion y Seleccid~n de Lineas Resistentes .......................................................................... 13 Producc. i6.1 4 evaluaci.6n cle hibsidos resistente;; ..................................................................... 20
COMI?ONENTE 13U3S: Marca'dores molecular^, s ...................................................................... 21 1ntrodc.ccihn ............................................................................................................................. 21
............ ............................................................................................. Materi, iles y Mitoclos .. 24 Resultatlos ............................................................................................................................. 27'
............................................................................ Resiste~lciii a nemitodos y Fttsa, rium raza 2 31
................................................................................................................................ DISCIJSION 33 il
........................................................................... CONC'LL SIONES Y RE:COjWE:NI)ACIONES 34
7 . ................................................................................................................................ APENDIC. kS 40
.......... l___-lll__----- . . AGROCY T 002-2002 . Informe final 'I 3 . '_:is h'ei ia IZA!JSP.C
RESUMEN
En la actualidad no existen en el mercado local cultivars con resistencia genCtica contra la virosis producida por 10s geminivirus Lransmitidos por mQsca blanca. Desde 1998 se han seleccionado en la Unidad de Riego Sansirisay, Sanarate, lineas resistentes. Estas lineas, sin embargo, no pueden ser utilizadas directamente para la produccion comercial de tomate, principalmente debido a que la calidad de sus fi-utos no es satisfactoria para su comercializacion en el mercado local, ademas de ser susceptibles a o t r o ~ patogenos de importancia y tener un bajo
. , rendimiento. En un intento por superar estas limitaciones, las meas resistentes fueron cruzadas con genotipos susceptibles a geminivirus, per0 resistentes a otros patoger~os y con buenas caracteristicas de fi-uto y alto rendimiento. A pwtir de estos hibridos, se se1ecc:- 13naron nuevas lineas durante ocho ciclos consecutivos. A partir del cu-?rto ciclo (octubre, 2003) se inici6 el cruce de lineas para la produccion de hibridos experimentales. Hasta ahora se ban producido un total de 353 hibridos experimentales, en tres grupos de cruzamiento. De la evaluacion de estos hibridos se hail seleccionado cuatro hibridos coil un alto nivel de resistencia a virosis, con resistencia a otros patogenos, alto rendimiento y buera calidad de fi-uto para e! nlercado local. Estos cuatro hibridos estan siendo evaluados y producidos comercialmente por Gentropic Seeds, S.A. Se determino que la resistencia derivada dz L. hirsutum en las lineas seleccionada no se encuentra asociada a introgresiones en 10s cromosoinas 6 (gen Ty-I) y 11 (gen Ty-2) por lo que se trata de una nueva fuente de resistencia. No fue posible establecer la localizacion cromosomica de esta nueva fuente de resistencia. Se desarrollaron mktodos de PCR para la identificacion de marcadores ligados a 10s genes de resistencia Mi-1 (Meloidogyne spp) y 1-2 (Fusarium oxysporum f. sp. lycopersici), estos se aplical,on en varias de las lineas de mejoramiento resistentes a geminivirus.
E:l t,orr~ate (Lycc>p,pcr..sicon esculetltttm Mill.) es un cultivo de importanc:ia e~o~nomica que ha sido producido en Ciuatemala desde tiernpos prehispanicos. A'stualniente (3uatelna.la C:S el segundo productor de torriate de Centroan~erica y el Caribe, despues de la Re176blica Dorr~inil:an;a, (:on un area .sembrada de 5,600 ha de un total de 128,200 ha (tdai-tinez, 2001'). 151 rendimiento pronnedio en C;uatemala es dt: apro.xin1adamenle 30 tl3nelaclas por hectirea, pero st: repo:rta 'bastante inestabilidsd en el rendirr~iento.
I51 tomate es un cultivo inlportante en la gener.acibn de empleo, como fuente de: subs:istencia y coniribuye si gnificativarne~~te a una dieta ma:; nutritiv,~. :La produccion de tornate sin embsrgo, c:au.sa un ~:orlside:rat)le impact0 sobre el ambiente, ya. que clerr~anda de un fuerte us0 de pestic;:ida.s. La efi:ct;iviciad de 10s pesticidas st: vl= rt:stringida. por dive.rscls factores, tales co,no su pc)ca efic.acia para el control dl: nuevos pai5genos o nuevas cepas de 10s ya existentes. Por otra parle, 10s residuos toxizos son sumamente peligrclsoc; para 21 iimbie:nte y la s.alud t;into del prodilctor como del consumidor. Ar;i misino,, estos pi-(sductos tienen un alto costo lo cual afecta la ya precaria :;it~~acion eclo-nornica de 10s agricultores. Una a1tl:mativa rnas segura para el control (11: 1;is enfern1,:d ad^::; es la introcluccion de resi:;tericia genktica eri 10s cultivo s.
Alrededo~ de 1986, una enfe~medad conoc,ida en nuestro nledio conno acolochami1?nt~ de la ho-ia, empez6 a afectar seriamente la prclduccibn local tle 1.omatt: (Salguero, 1994). Esta enfermedad tarnbien ha afectatlo a ol.ras regiones tropicales y subt~ropicales del planeta, incluyenclo Centroarnerica 11 el Caritbe, en donde se ha const-ituido en el principal limit en:^: para la produ:ci6n de 1:omdte y otros c.ultivo:; dc importancia econocnica y nutricional (RI-own y Bird, 1992; Brown, 1994; Polston y Andersan, 1997; lMora18zs y Anderson, 2001)). Cuando :[as plantrs son i12feceadas tei:npl.ano en su de:;arrollo 10s :;inl.omas que se desairollan son sul'~~arr~ente sevlxos, estos incluyen la dehrrnaciljn de las hqjas, el amarilla.miento y el 15na.nismo de la p!ant;a (Figura 1). L,os rl=ntliniiento; en e:;tos cas#os son pi.acl;ica~mente nulos y 10s fn~tos son pequefios y de maduraci'bn no uni forme.
4 GEMI:NI\~I RIJS 'TRZN5MI TI11 OS POI? MOSC A BL.ANCA
L,a e:nft:rmedad tlel a.coloclhar.niento de la hoja tlel ton~atc e!; causada. pclr a n t:ipo de vii-us pertelneciente 3. la farnilia (3eminiviridae y a1 genero Begomoviirus, L,os geminvirus deiivan su nombre cle su estructura fonnada :par particulas icosahtdricas bisejgmmentadas, ]?erdiCndose la infec1:ividad si ambat; uilid.ades son sepa.rat1as. Los Begornovin~s son transrniti.dos por la nnosca blanca (I3ernisia fabed Geonadius; Hornoptera: Plleyrodidae) (Figura I ) J.cs g&nirLivirus tienen genornas circullares c.ompuestos de ADN de filarner~to simple (rnonocatenario), este gerionla puede ser monopartil:~ (unis sola moltcula) o hipartito (dcs componentes, denominados genolna:; A y El). L,os Begomovi:r~s del Hemi!;feirio Occidental :son. bi:partitc~s (Goodman, 1 977; Lastra, 1993 1, R:unii:ez y Maxwell: 1994). Recienl.em.enl;e, un Begornovin~s rnonop art it? del Hemisfc:ric~ Oriental: el virus del enrollamientn ameLril.l.o cle la hoja del tclmate (TYLCV), Sue introduci.do en la region. de:l Caribe (Nakhla et a:. , 1994; ("zosnek y Latcrrol;, 1997). El TYLCV au:n no ha sido
_ _ _ _ - _ _ _ ____-_- - AGROCYT 002.2002 Info-me final '2
V
Qr. Lurs M~i ia , FAUSAG
Figura 1 . Sintomas severos de la enfermedad del awlochamiento ak la hoja akl tomate. -.
Figura 2 La mosca blanca vector de 10s virus causantes del acolocharniento a2 la hoja a21 tornate.
detectado en Guatemala, sin embargo, ya se reporto su presericia en otras parte:; dt:l coni;inente americ:ano (Polston et al., 1999) y 12n el sur de Mkxico, muy cerc:a cle rluestra frontera (Rivera- Bustarnar,.te, 2001, comu.nic.aci6n personzl). L'a introdu.ccion de este v in~s a nuestl-o pais podria tener consec~~encias nluy ac \,ersas para la prod.uccion de ton1i2te. Tambikn es iinportiiilte resaltar el hecllo clt: que el TYLCIV tambien ha sido identificadc~ en otros; cu.ltivos de gran :.n~porban'cia econo~nica y nutritional corno frijol y chile (Navas Castill~s ei: al., 1999; Roye e t a;:, 1990; Martinez ct al, 2:002).
El M ) N viral ~fue clonado y parcialmente :;ecuenciado, a partir de mu.estras de tejido foliar de tomate provenie:nte de :la 1Jnidad de Rieg,o Sansirisay ( [ J R S ) , Salariate: en. cc1lat1oraci6n con el Laboratorjo cle I). P. Nlax~vell de la. Universidad de FViscorisin-Madison. Se identificaron tres ge:mir~ivi~uses dikremte;;, lo:; cualcs han sido c-lenominados. virus c'el enr.oll~zmiento :;ev8.rc de la hoja lie1 tomate (ToSLCIV, selzur:ncia tlepositada en el barco de secuencias como A.F ,. .
13041!i), IIJ'YUS a'el mofea~do dorado del tomate (ToGIMoV, AF' 1:i2852;) y vir,sls die1 mosaico doradcl del pi.vlic?nto (I'epGFAV, AF: 1364043) (Mejia et a.1, I 998). R~=cientc:mlzntr st: him detectado en ~nueslras procedentes de la IJRS, por hibritiacion con sondas esl?~cificas: dos geminivinl:ses, adicionale:;: el virus Habaiza (del mosaico del tclmc!te (ToM:HV), previa:nente identificaclo en Hortduras; y el virus Sinaloa del erzrollainiento dt? la hqja del tomate (ToLCSinV), detectado en Costa Rica. PLsi mismo, se sospecha la presencia de otro virus adicional, el ~ i m ! s lizrc!steco ufell~lrrrietlto (PHV), prover~iente de MCxic:o (Maxwell, 2001, comuni:cat:i on personal)
Poco se sabe con I-especto a la ~ntrod.uccior~ del vector ,de 10s geminiv:irui, 1:1 mosca blanca, a1 herrdsi'erio'occide~~~al, sin. er.nbargo sllnbos organismos coexistierori dura~ te much3 tiempo sin afectalr si~nificativamente a la!; p1anl:as cultiv,ada.s (:Mclrales :y A~derson, 2001:). Con el cultivo intensive del algoclCln, y el ~~~~~~~~~iente USC) indiscrimirlado de pesticiclas, que tuvo lugar en Guatemala hace unos 50 afios,, la mosca blanca surgi6 comcl uria plaga importante en 1'3
costa del yaciiico. IE! ilso del insecticitla mel'an;!idophos permiti6 la rec-upcracioii temr~orril d.e este cultivo, percl rapidarnlen1;e la mosca b~anca desarroll6 resisten.cia, lo cual corldujo ;a pcirdidas severas. IIace urios 30 afios dio inicio la explotacibn de cultivos no .tradiciontales de e~cportacion (tomate, chile, melbr, brocoli: et~:.), con lo cilal se cre:aron ireas e:xtensiivar~ de hospedero:~ para la reproducci6n de la rnnsca b1;irtca .I.dernas, cl aument~~ponsiguiente en el uso dc 10s i11secticid:ls elimin6 a 10s cleprecladores naturale:; y propicio el ,apa.recimiento de :fonna:; rcsistentes. E:s en estos arnbisntes severamente i~lteradlos po:r el uso inte:nsi.vo de pes'tic:idas e:; que ;;urge 1 a rnosca blanca (:onlo una plaga trsms~risclra de enferrneclades virales de importancia. En 1986 se report6 en el estado de Florida una nueva y mhs a,gresiva fi3mia de la nlosca blanca, inicialmerite en la flor de pascua per0 :lue,go tanl1)ien e11 o.tros culti-vos, ir1c;luyendo el. tomate, en donde: se inicic'~ la transmi;sion de u11 geminivinls identiiicado como virus d'el rnoteaiio die1 tornate ('roIvloV),, causand.0 grande:; perdidas economicas (Abouzid et al., 1992). A finales de 10s :198OYs; esta nueva fi~rn~ii de la mosca blain~:a, el biotipo B o la rlueva especie B. argeritifolii, seglin algunos investigadc~res, ya fue detectatla en las :regiones tropicales y subtropicales del cor~tirrente arnericano y el C,aribe (:Bellows et al., 1994; :Brc!wn et al., 11395;).
,4ctuallnente en Guatemala 10s agricultures hacen masivas aplicaciones +e insecticidas t:n un intento por reclucir las altas poblacione,~ de rrlosca blanca. Sin embargo, ezltos esf~ierzos son
----- ---- ----------------------- AGR6rCYT QQ;1~2Q02, lnkrmo frniil 5 1 Dr, Lulo Msjla, F'AL SAC
en gran medida infructuosos debido a la gran eficiencia de la n.osca blanca como vector, bastando unos pocos insectos para propagar el patogeno y a1 aparente surgimiento de tipos resistentes a1 unico insecticida realmente eficaz en su control, el imidacloprid.
En 1936, se selecciono la Unidad de Riego Sansirisay (URS), localizada en el inunicipic de Sanarate, Departamento de El Progreso, como un area piloto para el estudio ds1 complejo rnosca blanca~gerniniviruses y su control. Esta aren reune varias caracteristicas deseables para este proposito. Entre ellas, el tener I:n tamaiio relativamente pequeiio y manejable, ser un sistema cerrado, aislado de otras areas agricolas y tener una produccion intensiva de hortalizas durante todo el aiio. Esta regi6n corresponde a1 bosque seco subtropical, caractt;rizado por tener dias claros y soleados durante la epoca seca y parcialmente nublados durante la 2stacion lluviosa. La precipitacion media anual es de 667mm y la temperatura promedio de 32OC. La unidad de Riego Sansirisay se tncuentra a una elevacion de 800 metros sobre el nivel del mar. A1 igual que en otras regiones productoras del oriente del pais, las plantaciones de tomate generalmente presentan un 100% de incidencia de la enfermedad del acolochamiento de la hoja. Aunque en la actualidad el cultivo Ael tomate ha sido practicamente abandonpdo, debido a 10s severos ataques de virosis. Esta area resulta ser tambikn un sitio de alta diversiclad viral, ya que se tiene la presencia comporbada de a1 menos cinco geminivirus diferentes, siendo un ~ i t i o en donde confluyen formas virales procedentes del norte y del sui de la region. Esta serib tarnbikn una situation favorable para la generacion de nuevos tipos virales, siendo la recombinaci6n entre moleculas de diferente origen uno de 10s principales mecanismos por el cual se generan nuevas formas en una planta infectada si~ultaneamente por varios virus diferentes (Padidam et al., 1999). La fuerte presion de seleccion generada por 10s patogenos alli existentes hace de la URS un sitio muy adecuado para el mejoramiento genktico para resistencia a geminivirus transmitidos por mosca blanca.
a
RESISTENCIA GENkTICA A GEMINIVIRUS TRANSMITIDOS P@Y MOSCA BLANCA
Los programas de mejoramiento para 12. pr3duccion de cultivares de tomate resistentes geminivirus transmitidos por inosca blanca dieron inicio a finales de 10s aiios 60's en Israel, estos fueron dirigidos contra el geminivirus del hen~isferio oriental TYLCV (Pilowsky y Cohen, 1974). Desde entonces se han realizado esfuerzos similares contra otros gemini~ irus (Kallo y Banerjee, 1990; Scott et al., 1996; Nakhla y Mauwell, 19P8). Debido a que no se ha encontrado ninguna fuente de resistencia en la especie cultivada L. esculentum, todos estos programas se bas?.n en la introgresion de la resistencia de alguna de las nueve especies silvestres de tomate, nativas del irea andina (Chile, Ecuador y Peni). En 1998, con financiamiento del Fondo Nacional de Ciencia y Tecnologia, FONACYT, a traves del Fondo para el Desarrollo de Ciencia y Tecnologia, FODECYT, sc realizo un proyecto de investigaci6n (FODECYT 48-97) para evaluar en la URS genotipos de tomate con resistencia a' TYLCV (Mejia, 1999). Los primeros genotipos fueron obtenidos de un programa de mejoramiento en el area del Mediterraneo dirigido por H. Laterrot (INIW, Francia) (Laterrot, 1990; Laterrot, 1992; Laterrot y Moretti, 1996). Posteriormente se agregaron genotipos proporcionados por H. Czosnek de la Universidad Hebrea de Jerusalen, Israel, (HUJI) (Vidavski y Czosnek, 1998). En 10s genotipos provenientes del lNRA la resistencia fue obtenida de las especies silvestres L. pimpinellifolium y L. peruvianum, mientras que en 10s de la HUJI esta provinc, de L. hirsutum.
AGROCYT 002-2002. lnforme final 6 Dr. Luis Mejia, FAUSAC
La eval~iacio;~ realizaila itn la IJRS permit10 la se1er:citin tle plai~ta:; con ciltc~s ratios de resistencia frentl: a 10s gerninivi:rus 1o::ales. El descubrimit:nto dl: que la resiste:ncia seleccionada contra un ger.ninivi;nis mo~lopartito del Hemisferic) Oriental. (T'Y1,C'J) se ina~lte~aia tarnbien coni:ra 8gerr~iniviiusc:: bipi-iltitos del Hemisferio 0ccidenl.al ~[como ToSI,CJJ, To(3MoV y PepGTv['V en la IJRS), brindo un renovado intel-es a este proyecto por part'? de nuestros colaboradclre!;. 13n 19\39 ,se contjnuo con el proceso die eva1uacio:n y selecc;ion de plantas resistentes. P~si mismo, se obtuvo line:as expenmentales ad.ici'3nales (TY 197, 1 Y 198, 8933) provenie~ltes del programa de m~?joramie:nto del Centro Volca:ni, Isr,ael:, ccln resi3te:ncia derivada de L.. peiwianum (1'ilow:;l:y 11 Cohen, 1990; Lapidot et al., 1997; Friedmann et ll., 199811. En 21 2,080 file posible nuevanlente obtener financiainiento del F'ONACY'T para continuar con el procescl de evsluacion y selection cle lineas :res;istentes conlra 10s ge.miniv:irus riativos (Proyccto FODEC'Y?' 8'3-99) (Mej i a, 2001 ; h.lej ia, 200 1 a). As:i misrno, f ~ e posible la obtencion de lineas experinien1.ales cle la Universidad dc Floridd, ccln resiste.ncia derivada de la especie silvestre L. -. .. chilenst: (Scoi:t et al., 1995).
Cuadro (abri 1 a
I. Comportamie~~to de cloce lineas resistentes cdmparadas con la lirlea susceptib septie:mbre, 2002).
L,inea
13711
G!h2 FAVI-13 Gh17
- - - - - - - - - -
1Z1 Chadrt) 1 muestra la .~ principales lineas ex erilnenta:les resistentes a virosis .I: transmiti'da por rrlos'ca '3lanca con las que se contahla!.al inicio del proyecto. Las 1.int:as Gh (G=(>uat8emala, h= hirsutttr,~) tler:ivan s u resistencia; de hibridos obtenidos tle la Universidad H.ebrea de Je~-~~sal.kn:, Israel (IKT.JI). Las lineas Gc (c:= chilense) heron seleccionadas a part-ir de l.ii-leas provenientes de la TJniversid-ad de Florida. La.s lineiis (3p (p= pertivianu,m) a p artir clc: lineas p:roveni en1:es del Cent1.0 Volcarli, 1:sra.el. Lo 'i 1' 1:nea. Gpinlper (pim:per= pim,pin ellijoli~sm y pen~vl',zntim) a pantir de ima. poblacidn segreg,ante del histituto Na~ional d:e Investigaci6n Ag~ori~n~icil , F'laricia (INRA). I,a linea GCO (C= Cuba!) fix selec~ionada del cultivar HC-7880 obten.ido cia1 h~stituto de Iinvcstigac:io~les Horti.colas "Liliana Dinnitrova'", Cuba (IIHLI)). El indict: de sc:ve~idiid tie la enfc:rmedad (DSI) se tdet:ennin6, a 10s 130 y 60 dias ttesl?uks del trar~splante, en una escala de 0-4. Una calificacion menor d.e 2. es considera.da inclicativa de resistencia.
------ -------------.--------------- AGROCYT 002-20132. lnforme final 7' Dr. Luis Mc!jia, IFALISAC
La comercializacibn directa de las lineas resistentes a geminivirus seleccionadas en la TJRS no fue posible debido a que la calidad del fruto no era adecuada. 10s frutos eran de una consistencia poco firme y 10s rendimientos eran generalmente bajos. As; mismo, algunas de estas lineas eran susceptibles a otros patogenos de importancia en la regi6n. La produccibn de hibridos ofrece la posibilidad de combinar en un mismo genotipo las carz.cteristicas de dos progenitores de diverso origen. En este caso, la de combinar la resistencia a geinini1:ii-u~ con la resistencia a otros pztogenos, un alto potencial de rendhiento y buenas caracteristicas de fruto.
En el 2002, con financiamiento FODECYT (Proyecto FODECYT 11-00; Mejia, 2003) dio inicio este cruzamiento. Se seleccionaron varias lineas de mejoramiento en las cuales la resistencia a geminivirus transmitidos por mosca b l~nca era estable (Cuadros 1 y 2). A partir de estas lineas se introdujo la resistencia a otros pat6genos y otras caracteristicas de inter65 agronbmico. Para que 10s genotipos resistentes pudieran ser transferidos a 10s productores era indispensable la introduccion de las resistercias basicas a patbgenos (corno a 10s hongos Verticillium y Fusuriunl) y otras caracteristicas relacio~ladas con el rendimiento y la calidad del fi-uto, como tamafio y firmeza. De esta manera, las lineas resistentes a begomovirus fueron cruzadas a cultivares susceptibles portadores de otras caracteristicas de inter& (Cuadro 3).
Cuadro 2. Cultivares susceptibles a begomovins per0 portadores de resistencia a otros patogenos y otros caracteres de interes.
I- I ~ u l t i v a r ( Origen y otras caracteristicas II
[ Very Firm I Israel, larga vida de anaquel, VFI 11
Sun Coast Rodade t Carolina del Norte, fruto grande, VFlFzl
Sur Africa, marchites bacteriaqa, V F , F ~ ~
' Resistencia a Verticilliu~n (V), Fusarium raza 1 (Fl) y raza 2 (F2), Stemphyllium (SM).
M-82
( HC-7880
Asimismo, se produjo hibridos por cruces entre lineas resistentes y susceptibles (Cuadro 3; R X S, H1 -H3 y H6-H3) y por cruces entr-qlineas resistentes (R X R; H4 y H5). Uno de 10s cultivare: m L populares en el area en esa'tPoca, el hibrido Marina (Sakata Seed Co.; H13) fue utilizado como control cn su evaluacion. Este hibrido tambitn se utiliz6 como progenitor en algunas hibridaciones. Algnnos hibridos resultantes de cruces con 10s cultivares susceptibles (Cuadro 2) fueron e l aluados a partir de finales do1 2092 (Cuadro 4).
Israel, tip0 para procesamiento, muy firme, VF, Cuba, crecimiento determinado, fruto firme para procesamiento, VFI SM
- - -- AGROCYT 002-2002. Informe final 8 Dr. Luis Mejla, FAUSAC
Cuadro 3. Comj>ortamiento cle kdbridos R X' S (HI -F13 y H6-H9) y R X l? (H4 H5) (septiembre, 200 1 a fc:brl=ro, 2002)
Hibrido II
-. .
2Hit)rido co~nerc:ial p o p ~ ~ l a r en el irea del estudio. '1ndic:e c.e sc:.~eridac: de la eniermedacl en una escala de 0-4, st 10s 30 y 60 dim de:jpui:s del tratnsplantc. Llna c:altficaci6n menor dc 2 cs considerada ~ndtcaltva de rzsis~encla.
Cuadro 4. ~Clornportamiento de hibridos entre lineas resistentes a \~irosis transmitida por mosca bla11c;a y cultivargs susc;eptibles (at~ril a sepliernbre, 2002).
-------- .------------------- ------ AGROCYT 002~.;!00:2, lnforme final 9 Dr. Luis Mejia, FAUSAC:
peruvianum. i1
Se p r o d u j ~ tambieil hibridos por cruces entre algunas de las lineas resistentes (Cuadro 5 ) . El cruce entre lineas con resistencia derivada de difcrentes fuentes produjo sorprendentes alto: niveles de resistencia. Este resultado result6 de gran importancia cuando se inicio el cruce de lineas para la production de hibridos comerciales.
Cuadro 5. Comportamiento de hibridos producidos por el cruce entre lineas resistentes a virosis
OBJETIVOS
OBJETIVO GENERAL
El principal objetivo de e ~ t e proyecto es la producci6n de hibridos resistentes a 10s gerninivirus transrnitidos por rnosca blanca y a otros pat6genos de irnportancia econ6rnica en Guatemala.
transmitida por mosca blanca (abril a septiembre, 2002).
AGROCYT 002-2002. lnforme final 10 Dr. Luis Mejia, FAUSAC
Prom. DSI 60
1.63
1.23
1.82
1.51
1.44
1.60
2.87
1.77
1.48
1.33
3.32 L.
Hibrido
H27
H2 8
H29
H30
H3 1
H3 2
Prom. peso/ fruto (gr.)
48.4
55.1
47.2
47.4
57.1
52.0
38.7
Descripcion del hibrido y origen de la linea resistente
TY-198 X FAVI-12 (L. per X L. hir) Gp11 X Gh2 FAVI-12 X TY-197 (L. hir X L. per) Gh2 X Gp12 FAVI-13 )': TY-198 (L. hir X L. per) Gh17 X G?11 FAVI-13 Y TY-197 (L. hir X L. per) Gh17 X Gp12 TY-198 X FAVI-9 (L. per X L. hir) Gp11 X Gh5 FAVI-9 X TY-197 (L. hir X L. per) Ghl X Gp12 ~ ~ - 1 9 8 ~ ~ i % m ~ e r ~ 1 3 (L. per X L. pimper)
Prom. rend./ planta (gr.)
1590
2372 A . .
1582
1478 -
2088
1877
1193
Prom. DSI 30
1.19
1.77
1.52
1.29
1.20
1.27
2.06
1.32
1.31
1.30
3.10 pimpinellifolium,
H3 3 i Gp 1 1 X GpimlO PimperJljXTY-197 (L. pimper X L. I per)
38.6
55.9
64.9
22.4
H34
H35
H36
H37
178 1
1622
1940
116
GpimlO X Gp12 FAVI-13 X FAVI-12 (L. hir X L. hir) Gh17 X Gh2 FAVI-9 X FAVI-12 (L. hir X L. hir) Ghl X Gh2 Control Elios (Peto Seed Co.)
pimper= L, pirnpi~~ell if~liu~ y L. L. hil- L. hirsutum, L. per= L. peruvianum, L. pim= L.
1. Ir~colporac.61-1 de genes l-le reslstcnc, a a a otros pattjgeno:; de importancia econon~ica (10s hongos clel suelo Yertzc-illium tdahliae y F~tsnr~urn oxyspc)ri~mz, razas 1 y 2; el virus del rnosaico del tanate (Ti'dV); la bacteria Pseudonzonns syrin~yze y 10s nernatodos lMe,'oitlogync? spp.) a lineas tle tomate I-eslstentrs a gemi111viru.s transmitidos por mosca blanca.
2. Selecci6n de plantas resistei?te< a gemirlivir-s tr:insmii.idos gor mosca blanc;a en base a ausencia de sintornas de infic~ion virai y tlajos niveles de ADK viral.
3. Selecc;!or\ar lineas resistentes a gzminivirus y portadoras tle 10s genes de resistencia i /e (9), I- 2 (1 I), Pro ( 3 , Ttn-2 ( 9 ) y Mi ( 6 ) utllizando marcadores mol~culares :y pruebas de: incbcul aci6n.
*
4. Cnlza:: las lineas rs:si!;tentes a geminivims tran.smititios por rriosca bla~nca. y ;a otros patogenos pa1.a la produccidn de: hibridos (:on n~.liltiple: resistencia.
5. Obtenel: fiutos tipo Snladette o Ikoina, de 80 a 120g cie peso y remdimientos de SO 'Ton/H:a
6. Evaluar hibndos con multiple reslstencia a 1fitopat6gcnos y de al:a calidad para el me]-cado guatenialteco, en condiciones de campo de productores colnel-ciales.
7. Detenr~inar la dingmica de lor gemirlivirus transmitidos ,ror mosca blanca ec la URS. En particular la introduccion de nuevo:; vlrus y la pro'duccitin tie nuevas formas viriiles.
El aiselio del proyecto incluyo tres componentes prirlcipales, dos relacionados con la evaluacion y seleccihn lde gernloplasma y otro con el clzs;~rrollo y uscl de marcadore:; moleculare:;. A continuation se describe la rnetodologia seguicla y 10s resclltados obtenidos el desarrollo dc los dos primeros compclnei?tes. El tercer componente, se describt- independie~il enlente.
.$I
COMPC)NENr.rE 1 : ES LrfLLrf,CION Y SELECCION I>E LINEAS R.ES[STENTES
Las :valuaciclne:; del g.ermoplas~nz para la seleccicin tie Eineas resistentt:~ 21 virosis transmitida por mosca blanca st= realizaron en la 'Unidad de Riego :San.sirisay (TXS), Sanwate, durante ochk 6pocas de riembra (de 2:002 a 2003, scis con financiiimien~;~ cde este proyecto (2003 a 200.5).
Corn01 se irtdico imteriormente, 1a.s 1j:neias grover~ierites de la U~iivc:rsidac.l Hyebrea de JerusalCn, Israel, (HUJI), deri~ra.n su resi:;tencia de la especie silves~tre L. hir:;utzrrn. La linein seleccionada. de la poblacion proveniente del GWA, Francia, deiiva su. resisliencia de L. pirnpinellifoiiun~ y L. ,perwv,ianurn. Las lineas se1t:ccion~das Cle las 1.ineas de mejorarniento provenierltes del Centro Volcani, Israel, derivan su resistericia de L. peruvianunr. :Las lineas obtenidas de la IJ~liversitlad de ITlorida dt:rivan su resistencia de .L. chiien~se. Es.tas lineas fu.eron
-------- ---- ---- -.---- ---------- AGROCYT C02-21002, lnforrr~e final 11 Dr. Luis Mejh, FAIJSAC
cruzadas con cultivares susceptibles y tambien con algunos hibridos comercialer,. Los ciclos de hibridacibn y seleccion se repitieron a lo largo de todo el proyecto. A1 mismo tiempo que se avanzaban las lineas de mejoramiento, se realizaban 10s cruces para la produccibn de hibridos F1, estos cran evalubdos y se inicio la seleccion de lineas a partir de las poblaciones F2.
La extraccior. de la semilla y la produccion de 10s pilones provenientes de las plantas seleccionadas fueron producidos pJr Pilones de Antigua, S.A. Dos semanas antes del transplante de 10s genotipos experimentales, se transplantaron genotipos susceptibles como fuente de inbculo. Estas plantas susceptibles se localizaron bien distribuidas en toda la pcrcela experimental, de esta manera se l o g o una inoculacion temprana y uniforme. La siembra se realizo en un diseiio de bloques a1 azai-, con diez plantas por tratamiento en dos replicaciones. En el caso de las poblaciones F2 se utilizaron un minilno de 30 plantas por tratamiento y 20 en el caso de las poblaciones F3. La distancia entre plantas fue de 0.4m y de 1 .Om entre surcos. Las practicas de cultivo fueron generaimente las mismas a las empleadas por 10s agricultores de la region, per0 sin ning6n control especifico contra la mosca blan~a. Los hibridos comerciales Silverado (tipo roma) y Sheriff (tipo chibola), de la compaiiia de semillas Ferry-Morse, actualmente 10s cultivares mas populares en el pais, fueron utilizados como tori-rol.
En el momento de la evaluacion (alredcdoi de 85 dias despuks del transplante), se seleccionaron las plantas individuales que mostraron mayor resistencia, mejor rcndimiento y mejor calidad de fi-uto_(forma y firmeza). Para la evaluacion visual de sintomas de virosis se utilizb una escala de 0-4 (Scott y Schuster, 1991), en la cual:
O= ausencia de sintomas visibles 1= presencia de sintomas visibles solo por inspeccion cuidadosa 2- presencia de sintomas moderados en parte de la planta y visibles a corta distancia 3= sintomas moderados a severos en toda la planta per0 con poco achaparramiento y 4= sintomas severos en toda la planta con mucho acaparamiento
A partir del primer ciclo del2004, cuan6o una buena parte de las lineas ya se encontraban en F4, se empez6 a utilizar una boleta para la toma de datos en la evaluacion (ApCndice 1). La Figura 3 es una guia de campo para la toma de datos, esta guia es muy util a1 principio per0 despuks de cierto tiempo ya no es necesaria. Esta boleta incluye el indice de severidad (0-4), la forma del fruto (50= redondo, <50= alargado y &50= aplanado), la firmeza del fruto (k30= firme), el largo tiel fruto (en centimetros), el peso del &to (en garnos), el color del fi-uto (P30= adecuado), el reildimiento de la planta (930= bueno), el vigor de la planta (k30= bueno) y una calificacion general (hasta 100). Ademas, se toman observaciones con respecto a1 habit0 de crecimiento (crecimiento determinado, semideterminado o indeterminado) y otras caracteristicas, generalmente indeseables, tales como la presencia de hombro verde en el fruto, la presencia de nudos en el ped6nculo o extremos puntiagudos en el fi-uto.
En las evaluaciones, ademas del equipo guatemalteco, principalmente L. Mejia y R. Teni, se ha contado con la participaci6n de D. Maxwell, Universidad de Wisconsin, en todos 10s ciclos y la de 10s mejoradolis de tomate J Scott, Universidad de Florida, en Septiembre, 2002 y F. Vidavski, Universidad Hebrea de JerusalCn, en marzo, 2004 y marzo, 2005. Coino resultado de estos ciolos de selecc;on, se ha desarro\lado una amplia gama de germoplasma resistente.
AGROCYT 002-2002. Infor.ne final 12 Dr. Luis Mejia, FAUSAC
Figura en las; (
3. Tarjeta de citmlm, para refixencia ripida, con escala para d iferentres pachetros util ev;3 luacione:;.
I Figura 4. I'olinizacibn manual paras la production de :;ernilb hibritla cle tr3mtle.
Figura 5. Lineas resistentes a virosis transmitida por mosca blanca con resistencia derivada de diferentes fbentes. L. chitense (c) y L. hirsutum (h). El cruce de estas dos lineas produjo el hibrido experimental XA25.
Figura 6. Linea resistente a virosis y control susceptible en la parcela experimental en Sanarate.
En el ct~adro '7 pueclc:n observarse 10s resultado:; obtei~id~os lun afio desputs, darante el primer cicilo del 2005. La r8=.:;isteni:ia en las lincax se mantuvo siernpre: por debajo de 2 y el niliel de fim1ez;l m,e~oro. Esta:~ linzas participan t:n un bloque de cruct:s cle casi 500 liibl-idos XA, la senlilla de: estos hibridos se esta terminarido de cosechar en este :momentcl y serAn evaluados durante el 2006.
El iiltimo ciclo de seleccidn penniti6 la :;elecci6n de alrecledor de cin.cuent;a lineas con calific;~ci6n gen.ei-z~l arriba tle 80 (Cuatlro 8)1. La n;ayoria de esta-s lineas son esta.bles (;on respect.0 a la resisten.cia. y otras ~:aracteristices, todas pl-esentim una bueila finne:ta de fnlto. Actual.mente ;s e i nicid, u n b loque d e c ru.ces c on algw as ti e e stas 1 ineas p :ua 1 a p roducci6n d e aproximatl;imente 300 hi'britlos IrCA qu.e se evaluarhn a finales del 2006.
Cuadro 6. I,inea,s seleccionadas en marzo 2004 con una calificac~on general iirriba de SO.
Linea
165h-1-a 117h-1-a 5 0 150 40 T47h-1-1-1 F7 50 20 40
Gh137-1-4 - - - 1 7 ' 4 1 --- -- -- -- -- -- - - ~ ? I T L z - ~ ~ T ~ % - - -- -- - --- Fruto I:@ roma o saladette
45140 Gh105-1-4
----- ------------ ----------------. AGROCYT 002-2002. lnforme firal 16 Dr. Luis Mejia, IrAUSAC:
Cuadro 7. Lineas cnn calificacitin general superior a 80 seleccionadas en abril 2005, ordenad~s oor forma v calificacion general. 1 U
Fruto redondo
Gc200-1-1 -b-2 Gc9 I ~andarina I F5 1 1.5 1 60 1 35 1 4 1 35 1 80 I 35-11
Linea
- Fruto tipo pera
Gc200-1-1-b-1 Gc9 Mandarina F5 1.5 58 25 4 30
Gc181-2-a-1.-1 G-9 Very firm F5 2 55 35 5 35 100
Gh159-1-2-1-a Favi Favi F5 1.5 55 130 1 35
P r W fern. / mast, Prog 1 Gene ; DSI / Forma / m. rac.
Fir / Larg. 1 Col. I Peso I Rend I V m l
Gh124-1-a-1-1
Gh124-1 -a-1-a
40
/
11 Gh202-4-1-a-1 I Verv Firm 1 Gh3 1 F5 1 0.5 1 50 1 35 1 1 35 1 90 1 35 1 30 1 80 11
Favi
Fdvi
Gh187-1-1-1-1 Gh187-1-1-1-2
Gh1148A-1-1-1
6
6
Gh160-1-1-2-a
Gh175-2-1-2-1
Ghc206-2-1-1-1
80
90 1 30
Favi
Favi
Gh13 Gh13
Favi
LA271 1 -b
Gcl78-I-b-I-a
Gc178-1 -b-2-a Gh1148A-1-a-1
AGROCYT 002-2002. lniorme final Dr. Luis Mejia, FAUSAC
Fsvi
GC16
Gh5
Gc43-1-a-?-1-b
Gc180-2-1-2-a
Gh124-1-3-1-a
F5
F5
Tomatillo Tomatillo
Favi
Fruto tipo bloque o chibola
Scott
Gc9
Gc9 Favi
Favi
Gh13
Gc7
Gc9
Gc9 Favi
2
2
F5 F5
F5
Scott
M82
M82
Favi
pera
era
F5
F5
F5
Hib.com.
Gc6 Favi
0.5 0.5
2.5
F6
F5
F5
F5
1.5
0
0
F6
F5
F5
50
50
50
0
2
2
2.5
55
53
52
2
1.5 2
25
35
50
48
48
48
35
35
40
40
40
5
40
25
25
25
35
35
30
30
30
4
4
4
4
4
4
160
140
120
30
30
90
25 / 75
80
70 '
45
40
40
35
30
30
25
30
80
90
80
40
40
30
30
40
35
60
60
60
50
50
30
25
40 35
30
85
85
80
80
85 80
30 100 / 30
35
30 35
80
35
45
35
90
80 80
/ I Fruto tip0 roma o s.aladette
Gcl76-2-2.a-a
Gcl80..1-b-l
-
Gc177.,2-a..a-l
-------- Gc185- I -a- 1 35
Hib.com. --- Gc43-I -a-7-a-I Gc9
10-04-4-a ? F6 0
Gh124-1-4-1-a Favi F5 2 32 6
- - - _ - - -_I-_------_----_I - - - - ------- AGROCYT C02-2002. Informe final 18 Dr. Luis Mejia, F'AUSAC
Cuadro 8. Lineas con calificacion general superior a 80 seleccionadas er, cctubre, 2005, ordenadas Dor forma v calificacion qcneral. - -
Prog. 1 PrOg' I Generac I DSI I 1 Firm. I Largo Linea
fem. rnasc. ma Color Peso Rend. Vigor General
11 Fruto t i ~ o pera 11
11 Fruto redondo 11
Gh124-1-a-1-1-a Ghp44-1-2-a-1-1 GTh551-2-a
( Ghl59-1-1-1-b-a / Favi I I I I I I I I
( Favi 1 76? 1 0.5 1 55 1 35 1
Favi GhplOXC'11 GA2
Gh57-1-a
Gcper210-1 -b
Gh159-1-2-1-a-1 Gh194-1-a-2-2-a
L. per. I( Gcper2lO-I-c ( L chi1 F1 ,,, 1 73 1 0.5 1 55 1 35 /
Favi Hlb. com. Hib corn
Gh25-4-1- a
L. chil. F1
Favi Ghl
11 Fruto t i ~ o bloaue o chibola 11
Gh187-1-1-1-1-a Ghp31-4-1-2-1-1 Gh25-6-1-1-1-e
F6 F8 F4
Hib. Corn. L. per. 197 Favi Rodade
Gh13 Gh5 Gh5
Gh25-4-1-a-1-1 -a Gc180-2- 1-1-1-1 Gc43-5-4-1-1-1
AGROCYT 002-2002. lnforre final 19 Dr, Luis IWejia, FAYSAC
2 1
2.5
i 4
F3
F6 F6
11 Gh188-1-6-1-1-a Gc143-1-1-2-a-a
, " a
Tomatillo G p l l GC6
38p 33p 25p
1.5
1
1.5 0.5
Gh5 Gc9 Gc9
Gh13
F6
F 8 F6
G C6 GC6 Hib. C O ~ .
Gc43-4-3-1-1 I Gc9
50
40
55
55
55 55
F6 F6
M82
0.5 1 2
40 40 40
2
2.5
Hib. corn.
4
6
40
43
35 30
F6 1 1.5
F6 F6
50
50 48
35
F6
30
25
1.5 1.5
35
45
4
1
80 90 80
90
110
150 90
33 33
30
30
33 ,
40
45
50
45
35 35
40 35
40 90 100
80 90 80
100
30
25
45
40
40 40
4 4 -
85
- -- -
80 85 85
40
- 4 5
35
90
85
-80. ' 80
30
.
40
35
30
85 85 83
90 80 80
80 85
45 40
30 30
85 85
Linea Generac
Gc180-1-b-a-1
Gcl80-1-b-a-a
Gc143-1-1-1 -a-a F6
Gcl43-1-1-3-a-a F n3
85 80
GTh550-1 -a
PRODUCCI~N Y ESV&LLUAC:I6I\J DE HfBRI:DClS RESISTENTES
El t::ruc:e tle lineas resistente:; para la 1)roduccihn tie lnibridos experimentales se inicio a finales del ;!O03, El primer grupo de 60 hibridos se evialuo en octubre, :2004 (lXA1 a XA61). Otro grupcl de 292 l-liblidos (>:A62 ii XA333) se evalud en ~na~-zo, 2005 y un ultimo grupo de 20 hibridos (X.4334 a X ~ 3 3 . 3 ) (XI octubre 2005 (Cnaclro 9). De estas eva1uacion.e~ se :har~ seleccionatlo sejc; hibridos cc~n potencia1 com.erc;ial (X:C4., XC25, :XC1173, :<C27:1, XC273 y XC339:). I>e todos 1.0s hibriclc~s comlerc:iales fie ha producido semilla en canticlades semicolnerciales y se realizan pnleb'as en miltiples localidade:;. 1,os hibridos XC4, XC2'73 :y XC339 so11 lo:; considerados c:on mayor potencial (Figuras '7, E; y 9).
Cuadro 9. Hibridos ev.aluados durante el segundo ciclo del 2004 con califica~itjn ,general mayor de 80, ordenaclos por calificacion, gecei-ai. -----
5 5'0
75 40 1#5 40
3' 5 35 85 --------- 3 5 80 40' 35 85
3 3 80 40 38 85
3 0 100 35 35 85
411~-4.-3-1
75 35 40 85
4:)~-4 -3-1 - ----- - --- 35 35 75 35 35 85
------ 35 35 90 35 35 85
3 0 70 35 40 85
35 85
- ---------- -- --------------------- AGROCY-r 00:!-2002. Informe final 20 Dr. Luis Mejia, FAL SAC
COMPOPJENTE TRES: lylarcadores moleculares
Varios programas de investigacion han introducido a L. esculenturn genes para resistencia a begomovirus a partir de especies silvestres de tomate. Como se indico anteri~rmente, las principales lineas que estan siendo utilizadas actualmeqte en Guatemala y clue poseen altos niveles de resistencia a begomovirus, son las derivadas d8 genotipos obtenidos l e 10s programas de mejoramiento de F. Vidavski y H. Czosnek de la Universidad Hebrea .le JerusalCn (L. hirsutum como fuente de resistencia) y de J. Mr. Scott de la Universidad de Florida (L. chilense como fuente de resistencia). Por lo tanto 10s esfuerzos para encontrar marcadores ligados a la resistencia se han colicentrado en 10s genes de estas fuentes, y principalmente en las lineas con genes de resistencia de L. hirsutum, la mer,os estudiada. La estrategia molecular se bas0 en el desarrollo de primers o cebadores para PCR a partir de sondas RFLP 1ocali::adas en la regi6n de una introgresi6n, conocida para el gen Tyl de L. chilense, en el cromosoma 6 (Zarnir et al., 1994) y para el gen Ty2 de L, hirsutum en el cromosoma 11 (Har~son et al, 2000).
1
AGROCYT 002-2002, lnforrne final Dr. Luis Meiia. FAUSAC
Larg
5
6.5
6
5.5
5.5
6
6
6
5.5
6
6
5.5
5.5
5
5
Hibrido
XA3 11
Prog. Masc.
23h-1-1-a
Prog. Fern.
Gc173-2-a
Color
30
33
35
35
35
35
30
30
3 0
35
30
3 0
35
35
35
35
30
, 35
XA321
XA165
XA243
X.4239
XA253
XA280
XA295
XA273
XA234
XA266
XA279
-324
XA331
XA314
XA3 13
XA185
XA196
DSI
1
3 3
3 5
1.5
0.5
1.5
1
1
1
0.5
1.5
1
1
1
1.5
1.5
1
1.5
!.5
0.5 - 1.5
0.75
Peso
70
90
120
90
70
75
60
85
85
75
80
70
75
75
70
70
110
110
Fol-~na
4 5
90
100
GA2
Gc9-b
Gc43-4-3--1
Gc43-4-3-1
Ghp44-1-3-1
Gh124-1-a
Gh143-1-1
T44h-2-1 -a
25h-2- 3 -2
T44h-2-1-a
124h-1-a
GA2
44hp-1-1-a
173c-2-a
173c-2-a
31hp-7-1-1
117h-1-a
Firm
45
45
55
30
33
33
3 3
33
33
35
35
35
35
35
40
45
55
55
55
55
Kend
40
40
35
35
38
40
45
40
35
33
40
38
35
35
40
40
35
35
T44h-2-1-a
117h-1-a
105h-1-a
23h-1-1-a
2511-4-1 -a
171c-1-a
T44h-2-1-a
173c-2-a
137h-1-4
45hc-1-1-2
137h-1-4
124h-1-a
47hp-1-1-a
105h-1-a
45hc-1-1-2
160h-1-2
21h-3-2-1 gi:i 122h-1-3
25h-2-1-2
35
3 5
35
30
30
35
40
35
35
30
30
33
35
33
35
30
3 3
3 3
38
38
33
44hp-1-2-a
23h-1-1-a
Vig.
35
40
40
35
38
35
38
35
40
35
35
37
35
35
40
35
35
35
Gral
85
85
85
80
80
80
80
80
80
80
80
80
80
80
80
80
80
80
35
35
1 80
80
Figura 7. HiZ,riclo ~.esistente a virosi!; XA2'71 :y control :susceptible eirl Sanarate, rrrarz;o, 2005. ~, *
Figura 8. Toti1 tie h t o s procedente!; de: una sola planta de un hibrido rr:sistente (XA27ii) en comparac:ior~ con 10s proc:edt:nks de un co~itrc~l susceptible en Sanarate, octubre, ,2005.
Figura 9. Hibrido comercial XC273 en parcela experimental durante un dia de campo en Sacapulas. Quiche, en enero, 2006. -+
Figura 10. Dia de carnpo en Sacapulas, Quiche en enero, 2006. Los productores observan en hibrido comercial XC273 promocionado como San Je&nimo por Gentropic Seeds.
1. Aplica.citin de marcadlo molecnlar basad.0 en 1'C:R La. estrategia gt:ner;il ;rue secuenciar las sontlas RFLlP localizadas (en la regi6n d~e la
introg~-esi6n de:l gen Tyl o Ty;?. Est:as s0nda.s fueron identificadas e:ri articulos pul11ic:ado.s y en 10s mapas c~~omosom.icos en el sitio tie :la Solnnz,!m Gerzorae .Nel%clrk site (www. c;gn.cornell.~:du). Estas sec'uertciils :heron. util.iza.das para bi scar s;ecuen.cias h.omologas en t7errBank y la base de datos del genoina de Arabla'opsis thc!li(lnc (mips~.gsf.de/projects/plan~:s). Se dise~iaron cebadores de PCIR p'ara re:co.nocer sec~~encias ct)ns.er.radas 'cn 10s exont:s entse I;. esctile~ttum y A. thali,rrna, de manera que por lo rrienos un intr~jn o mas, de ser Iposible, 1Fue:ran an1plific:ados ]?or el par de cebadores para P(:I;I. 1,os fi-ap~t:ntos de PC'R fueron cloniidos y secucnc:iaclos o :;ecueticiados directamc:nte:. :Estas secuencia:; ftleron cornparatlas por nledio de progriimas d ~ , cornputacion de ADN, tales como lGClG o Lll.TAMk'lN. -. ..
2. In~:ro~:iresi6m en i l CI-on nos om;^ 1.1 correspoo.diente al gen 'Ty:l El geri Tj).? cle ,!. hirxtum \-ar, gltzbr,att~rn nccession 6'6013 esta localizrido en el cromosoma I. 1 (Fig. 1) (Hanscln et a.l., 2000). St: o'btuvieror~ y secuenciaron las sondas TG1.05, 1G26 (pLCE, PstI, :2,400 bpj), 'TG30 (PLJC8, EcoRI, 21,000 bp:), 'FC.36 (p-UC8, PstI, 3,;!00 bp) y 'TG3913 (pGET\/I4;:, PstI, 1,200 bp), localizadas en esta re:=i6n. La linea resistente, H24, homoc~igota para el gen 0 2 ftie proposcionada por P. 13anzon clel Centro A.sii.tico para In~es~tigacibn y 1)esarrollo de Hortallaa:; (AVRI)??;C). C . Spooncr, USDA y Departamento de: Horticultul-:l, Univt:rsidad dl: Wisconsin-M~dlison, prc~po:rc:iono .ADN de L. hir,sut;stm, ac:ce:;iones 1928 y 1353 y L. hi,rsututiz f: glabratum, LA 1223 (Spooner . . . Anler. J. Botany 88: 1888- 1902). Laas : ineas su:jceptil~le:; de L. esculentuni fileron L. esc:ule~!tum var. cei~asfoume y M82.
Figura 11. Crorr~osoma 11. Ida region sorl-~bresda inclica la localin:aci6n de la i:1trogesi6n de L. l ~ i r ~ t r t t ~ t ~ ~ (Hanson e t al.., 2000).
6.0 - 3.9 - 'fG 106& d-* 2
TO :26 ---------
4.7 - dl: la 1ntrt)gre:jibn de L. TCi ,393 +---- 1rr:;utu.n ert el ~:romosc~ma I 1 cle L. I
- - - - - - - - - AGROC'IT 032-2002. Informe final 214 Dr. Luis Idejie, FAUSAC
El disefio de cebadores para PCR para la amplificacion de fragmentos dc: la regi6n de la introgresi6n del gel1 Ty-2, incluyo la sintesis de cebadores para 10s marcadore; RFLP usando la secuencia de 10s extremos de las solladas TG36, TG30, TG105, TG26, C'T120 y TG393. Se encontro que la secuencia de TG105 (M13F) mostr6 una alta identidad (95%) con la secuencia de un clon BAC de Solanum demi.ssium, AC091627. i o s primers PlO5s (5'-ctt cag aat tcc tgt ttt agt cag ttg aac c-3') y P105c (5'-atg tca cat ttg ttg ctt gga cca tcc-3') produjeron un solo fragment0 de 450bp con varios genotipos de tomate. Estos fiagrnentos de PCR fueron secuenciados directamente (Fig. 3).
3. Introgresiones en el gen Tyl del cromosoma 6 Para el gen Tyl, se secuenciaron 10s clones de las sondas TG297 y TG436 en el cromosoma 6 localizadas en la region de la introgresion de L. clzilense en la linea resistente TY52 (Zamir et al, 1994) (Fig. 2). La linea TY52 y la isolineas TY50, sin la introgresion, fueron proporcionadas por D. Zamir, Universidad Hebrea de Jerusalen (HUJ). El mapa RFLP de la introgresion fue proporcionado por H. Czosnek, el cuAl muestra la introgresion entre TG97 y TG232.
Fig. 12. Cromosoma 6. 1 ntrogresion de L. c hilense (Zamir e t al. 1994). La sonda TG436 se localiza en la region comprendida entre Tyl y TG25.
Para el disefio de 10s primers, se secuenciaron las sondas RFLP CD67 (sin secuencia), TG97 (PstI, 1.4 kb, sin buena secuencia), CT216c (EcoRI, 1.7 kb), TG232 (PstI, 1,415 bp), TG297 (PstI, 1,807 bp), TG436 (Pstl, 1377 bp, HUJ; PstI, 1036 bp, (~niversidad de Cornell). Las secuencias ds cada sonda fueron somparadas con bases de datos de Arubiopszs y GenBank. CT216c tuvo la homologia en un exon y un intron con AT5g59550 (no se diseiiaron primers). TG232 tuvo una identidad de 70% para 28 - 496 nt con AC009991 (PTG2?2sl/PTG232cl). TG297 tuvo una excelente homologia con AT5g227i0 y se identificaron 8 exones (P297s3, P297s6, P297c6, P297c8). La secuencia para la sonda TG436 de la Universidad de Cornell fue
AGROCYT 002-2002. lnfor~ne final n, I ,,;- nr,;:, C A I l c A r
hornologa con 10s exores 5 y 6 de r'lt2g476E;O (AM?-helicasii .A A'rP-dependicntt:) (PCT436~5b/P(3T336~6).
4. NFLP - biisquetla de rnalccadores Xgados a genes de reisistencia a begornovir~is (en una linea de Ciuatemala
Debido a clue no st: detect6 ninguna region de in1;rogresion para 10:s genes cle resistencia en las lineas dr:rivadi~s ;ie 902, se decidib emplear una estrategia basada en FCFI,P. El A D N de dos lineas suscegi;ibles (HC!7880 y :ME,2) y una linea resis'ten.te a begomovirus en (;ua.ter.nala (Ghl) y derivatla 'de FA.VI '3 (genes de resistencia de 902) :je ntiliz6 para un an;ilis,is por RI'LI' con sondas rnarcadas ccln '"P correspondiente:~ a cada uno Cle 10s 12 crc,mosomas. El AIIN fu-, digerido con c into enzimas d e r estrir,cion: D raI, f5 coRI, E colXV, Hindi o X.ba I. C hrl, asribs TG30 1, E:II nleclio T(jl9; (:hr2, arriba TG227; C:hr3, en medio TG129; CIlr4: arriba TG146, en medio T(362, ahajo TG450 ; Chr:j, arriba TCi23, abajo CD'74; Chr6,, arriba TG231, T'G1 19, en medio TG54., abajo TC422; Clhr'7, arriba TG4318, abajo C:D54, C~I-8, arriba TG41, en medics. - TG28.2; shaj 3 TG402:; C:hr9:, arriba 'I'G10, abajo TG8; Clu-:L L, a.rriba 'TG 194, abajo 'TG30, T(326 (region dl: la iiil.roj;re;;ion deI gel1 TY:2); Chr 1 ;!, en med.io CT79, abajo C3D2.
5. Deteclzi611 del ger: M.i-1 para resistencia a otrmatodos Lir resistencia a ne~nato~dos (iMe!oicl'ogyne spy.) en el tomiate es1:a controlada por el gen
domin.ante Mi-1. Este2;en file iiltrod.uc:ido de la espec.ie si1vesr;re L. ,peruv,tanum (Smith, 1934). El gerl Mi-1 es'ta 1iy.do a 1rlarc:adlsres en c:1 crocnosomd (5s (Ho et a:[., :1992). Se han mapeado otros g e n s para resistencia ;r enfeimedades en el cromosoma 6S (Pang t:t al., :?000; Zhmg et al., 2002); pclr ejemplo el gen para re:;istencia a1 Tojenato :delr'ow le,czf curl virus, I)-,:. El marcado:: codominante REX-1 (prim(:]-s cle I'CR RE:<-F'IAXEX-IU) es utilizado para la deteclcion del gen Mi-1 ~:Williamson et al., 19134). Iletlido a que el marcador REX-1 por si sol; protiujo alguno:; resultados fa.lsos :positives en lo:; g;enotipos utilizadaos, fue necesa.rio el dl:sai~ollo de otro:; primers (F'M3Fb/FbM3Rb) para urla reaccion PCR multiplex (:El Mehracli e: al., 2005). Lo:; primel-s F'Eui?Fbl (5' CAC r'lCA TGA GG?' ATC; TTC GTA. T'TA T(3G 3') y Plui3Rb (5' TCP, CAG {ZC'I' AGC T'TT TGA .4TC AGT ACC 3') :heron diseiiados pars reconover la region 3' del gen Mi-1.
6. De~teccibn dtel gen 1-2 para resistencia a Fus,ariurn raza 1 La resistencia Fusariunz oxysporum f: sp. lyct3pt:rsici (FOL) esta detennirlada por lo:;
genes 1-1 (FOL ram I) y 1-2 (FOL. raza 2) introducid$ de L. pimpinellijolium. Estos genes ha11 sido rr1apc:ados en el cromosoma 11, el loclls ]:-I en el brazo co:rto y 1-2 en el brazo largo (5, 8). Debido a qut: la stxuencia c.e ADN del gen 1-2 habk siclo 1)utllicada en ell Ged3ark, Na.cional Center for Bj.otechno:logy Information, Sue posible dise9ar una reacci.6n de PCR multiplex para su det[:cciOn (E'1Mohtar :y P~bou-Jawaah, 2005). Se utiliziaron dos primers ;:eversos, TE;us:rrl (5" CGA ,4GA C;TG AT'T C;G,4 G.4T 3') y TFusirr2 (5' CCT GGA. TGA. ACA. GCT G.ACi 3') y un primer del;mtero TFusF1 (5' CTG AAA CTC 'I'CC GT.A TTT C 3'). ILas mezclas de reacci6r. dc: 20 o 2.5 ~ 1 1 con:;istieron de 2:-2.3~1 de a~aortigua'dor 10X, 21nN[ N[gC:12, O2uM cle cada prinier,, 200mld de) cada dNTP, 1 unidad Cle Taq, po!innerasa y 2u1, dr: ADN II-~uestra o api:oxim:ada.mentt: 60ng de ADN. Las c:ondiciones de PCR fueron una denaturaci6n iniciql a 95 C durante 3 n~ in , seguida de: 35 ciclos a 94 C' durainte 1 mil?, ti7 C durante 1 min y 72 IC dui.,ante ? min, y una extension final ii 72 C durante 10 nnin.
- AGROCYT ClCm2-20021. Infornie final 26 Dr. I-uis Mejia, FAUSIAC
Introgresi6n en el cromosoma 11 correspondiente a1 gen Ty2 En una region de aproximadamente 160nt, la secuencia de H24 con una introgresi6n del
gen Ty-2 de L. hirsutum para resistencia a ToLCV, comparte 10 SNF's y una indel grande con las tres accesiones de L. hirsutum (Figura 13). Estas scn unicas para H24 y las tres especies silvestres y demuestran claramente que una introgresion ocurri6 en esta regi6n del cromosoma 11. Debido a que estos SNF's y la indel no estan presentes en 902h, Ghl y Gh2, todas las cuales tienen resistencia a begomovirus derivada de L. hirsutum, se concluye que el locus TG105 no contiene el gen de resistencia para estas lineas. 'TY52, TY50, Glh, cerusiforme y HC7880 tienen una secuencia idkntica en esta regi6n y Ghl es resistente a begomovirus en Guatemala mientras que las otras tres s3n susceptibles y TY52 tiene la introgresi6n del gen Ty-I qn el cromosoma 6. Los resultados obtenidos con el locus TG105 demuzstran que este mktodo de marcado basado en PCR puede efectivamente ser utilizado ?ara identificar regiones de introgresion de especies silvestres.
902h 5 9 G9c 5 9 G2h 5 9 HC7 8 8 0 6 0 Cera 6 0 Glh 6 0 TY52 6 0 TY5O 6 0 H2 4 6 0 hir 1353 6 0 hir 1928 6 0 hir 1223 6 0 Consensus
902h TGTATTTATATTTACAAAACTAAAATTTAATCACTATATACAACGTM.TTTTCCGACAAA 119 G9c TGTATTTATATTTACAAAACTAAAATTTTAATCACTATATA~~~GT~TTTT~~GA~~~ 11 9 G2h TGTATTTAnATTTACAAFWCTAAAATTTAATCACTATATACAACGTAATTTTCCGACAAA 119 HC'i880 TGTATTTATATTTAtAAAACTWTTTAATCACTATATACMCGTAATTTTCCGACAAA 12 0 Cera TGTATTTATATTTAtAAAACTAAAATTTTAATCACTATATACMCGTMTTTTCCGACAAA 1ZC
AGROCYT 002-2002. Informe final 27 Dr. Luis Mejia, FC,USAC
G l h 1 2 0 T Y 5 2 1 2 0 T Y 5 0 1 2 0
H 2 4 1 2 0 h i r 1 3 5 3 1 2 0 h i r 1 9 2 8 1 2 0 hir 1 2 2 3 1 2 0 C o n s e n s u s
9 0 2 h 1 4 5 G 9 c 1 4 5 G 2 h 1 4 5 H C 7 8 8 0 1 4 6 C e r a 1 4 6 G l h 1 4 6 T Y 5 2 1 4 6 T Y 5 0 1 4 6 H2 4 1 6 0 hir 1 3 5 3 1 6 0 h i r 1 9 2 9 15 9 h i r 1 2 2 3 15 9 C o n s e n s u s
TG'TA7'TTATATT""At AA~~~,C'TAAAI.~TTTR~TCACTA'~A'IIACM(?G?'AA'TT~?TCCGI~CFLAA
'rGrrATTTATAT?'?'At .W~CTRWLTTT&S.~C~ACTA~~A?'AC.AACGTAA'~TTTCCG~~C~AA
'rGTATTT.4TATT ? Atd2AIACTAiV-IF,TTTAlic C'ACTAYATAC,UCIGTMTTS'TC ClGACgAA
:~G'~~ATTTATI~TTTA~~WACTA~M.TT'TA~~~CAC'I'ATATACIZACIGTAAT?TTTCI~G~ iCgAA
'i?GTATTTilTPiTTTAtlW.ACC'I'AITT'rAF~c CAC'I'Al'ATAC2lAC1GT.4ATTTTC(':aP.Cg.4A
t . g t a t t t a t a t t t 3. aaaacl:aaaattt;aa*ca~tatatat~~Ci~acgti~at t c ac*aa
C:C-A.GT(X"G. . . . . . . . . . . . . . AGCCZWGGTAGGTCCTG
CGAGTGTCG . . . . . . . . . . . . . . AGIX?AGGT;\GC:TCCTG
GGAGT(;TCIG . . . . . . . . . . . . . AG(7CPAGGTiiGGTCCTC;
GGAt3TGTCG. . . . . . . . . . . . . . AG(:CAAGGTJiGGTCCT(;
GZA(3TC:TCG, . . . . . . . . . . . . . .4G('C1AAGGTfL3GTC(3TC;
GGAGTGTCG . . . . . . . . . . . . . . AGCCAAGGTAGGTCCTC
GGA(;TCTCO. . . . . . . . . . . . . . iIGCICAAG(;TA.GG8TC('TG
GGAGTGTCG . . . . . . . . . . . . . . AGCCAAGC;TAGGTCC:TG
G(;AC:TGTCC;c t;cgacacccc t tmra.CCAAGC;TAGG'rCC'Tc
GGgGTGTCGc t . c g a c a c : c c c t .kyc_[aCCAi\GCITAGGr.CCC'Tc
GC:gC!TG TC<<c t c g a , s a c ! c c c ~ ~ S ~ ~ C C L A G C T A G G T C C T C
GG:AGTG'TCC;c t c g a i s a c r c c c t tgg .aClWiGGTAGG1'CCTc
gg*gtgl:cc_l****:C:C**********ccaaggtaqgt,cct* - C'
Figura 13. Secuenci:~ de fragrnentos de PCR amplil'lcados con el pa.r dl: prim1:rs Pl05s,'P105c en lineas de tomate y h-es accesiones de la espe'zie silvestre 1;. hirszlrurn (~Yrner. J . Botany 88: 1888- 1902). 902h, linea con resistencia a TYILC'V derivadz. de L. hir.~utum (Vidavski y Czosne:k, 1998); Gc9, linea se1eccio:nadp en Guatemala cle ];la 595-2 con resistencia a TYLCV y a 'rolvloyL7 de L. ct;!ile~zse (J. Scott); Gh2, linea seleccionalda clel tiibrido FAVI 12 (resistencia a begomovirus derivada de 90:lh). H(37880: cultivar tle polinizacibn abierts tfe Cuba susceptible a begomovirus en Guatemala; Cera, L. zscule~ztu~n vur. cerasifon~e colec~ad~o en Sanaratc, Guatemala, sus(:epl:ible a b-gorr~ov~.rus; Ghl, linea c;elecciona.da del hibrido FAVI 9 (resisten.cia a begomo\~irus d~:ri\.ada dc: 9C12h); TY52, isolilnea con el gen Ijl-1 de L. chilense (2,arn:lr et al., 1954); TY50, isolinea sin el !;en T y l para resistencia a T'ILCV; H24, linea con una introgresidn del gen T y 2 cle L,. hir,sut~tm en el cronlos'oma 1 1, en la regi6:n del nlarc~dor I'G105 (Hanson et al. 2000).
-------------------- AGROCYT 002-2002. Inforrne ti nal 2 i3 Dr. Luis Mejia, FAUSAC
En el locus TG105, el fragment0 de PCR PSNP105s/PSNP105c fue secuenciado en 11 lineas de toinate y en las tres accesiones de L. hirsutum. Para las 11 lir~eas de tomate, hubo tres patrones de SNP-indel, el tipo esculentum, el tip0 hirsutum y el tip0 chilense. Las lineas Ghl , HC7880, M82, Gh3 mostraron el tipo e.sculerztum, las lineas Gh2, 902h, Gc9, y Gp11 mostraron el tip0 chilense y las lineas H24 y CLN2498-68 mostraron el tipo hirsutum. De manera que, las lineas derivadas de 902 en Guatemala, unicamente presentaron 10s patrones tipos esculentum- y chilense-per0 no el tip0 hirsutum.
Introgresiones en el gen Tyl del cromosoma 6 La i nformacion m as u ti1 s e o btuvo c on e 1 p ar d e p rimers p ara P CR d el 1 ocus T G436:
PCT436s5b (5' cct tcc aac ata cta tgc act tga gc 3') y PCT436c6 (5' ccc aga aaa ctt gta aag aac ggc 3'). Este par de primers produjo un fragmento de PCR de aproximcdarnents 900 bp, el cud fue clonado y secuenciado para L. hirsutum LA1223, Ghl, TY.52, TY5G y FC7880. Se detectaron dos indeis (Fig. 14) entre estos cinco genotipos y TY52 y Ghl compartieron el misino patron indel. Debido a que estos dos eran 10s genotipos con resistencia z begomovirus, se disefiaron dos primers para PCR parz amplificar un fragmento de 300-bp (PSNP436s, 5' tct gca agt cgc atc gga agg tat gc 3'; PSNP436c, 5' gta tgg gcc acc tgg cat gca cct cg 3') que amplificaran la region con las dos indels.
Este par de primers fue utilizado para arnplificar un fragment0 de PCR, el cual fue secuenciado en 10 gewtipos adicionales. Los genotipos fueron divididos en 60s grupos en base a las dos indels (Fig. 4). I,os que tienen secuencias tipo esculentum y 10s que tienen secuencias TY.52 o tipo chilense. Los comprendidos en el tipo esculenturn fueron TY.50, HC7880, M82, Gh3, G p l l , CLN2443A (gen Ty-2), CLN2498-68 y H24 (gen Ty-2). El grupo con secuencia tipo chilense incluy6 a TY.52 (gen Ty-I), Ghl, Gh2, 902h y Gc9. G9c tiene resistencia a TYLCV y ToMoV derivada de L, chilense, por lo que podria tener el gen Ty-I. Las lineas con resistencia a begomovirus en Guatemala se distribuyeron en ambob grupos, lo cual indico que esta region no es la el sitio de la introgresion de L. hirsutum, ie en Gh3.
Debido a la presencia de una secuencia tipo chilense en dos lineas resistentes de Guatemala, Ghl y Gh2, la presencia o ausencia de estaz dos indels fue determinada en poblaciones F3 provenientes de cuatro cruces. Las lineas con resistencia a begomovirus Ghl y Gh2 fueron cruzadas con las lineas susceptibles HC-7880 y M82. Los hibridos F1 resultantes fueron sembrados a1 inicio del 2002 (Cuadro 10). Las poblaciones F2 fueron sembradas a1 inicio del 2003 y se selcccionaron plantas resistentes y su%ceptibles (10s fenotipos mis extremos) en marzo, 2003 (ver imageries en el siguiente sitio de internet: http://www.plantpatl-..wisc.edu/Geminivii iisResistantTomatoes/CDR/Mar03/H16RS.htm). Se extrajo ADN de una mezcla compuesta de tqjido de la progenie de estas plantas (aproximadamente 15 plantulas:. Este ADN, asi como el ADN de las lineas progenitoras, fue utilizado durante este period0 (Julio, 2003) en la busqaeda del marcador indel en la regicin 436 del cromosoma 6.
AGROCYT 002-2002. Infarme final 29 Dr. Luis Mejia, FAlJSAC
Cuadro 1 3. Hibritlos evaluado:; en Cuat e:nala de septi =n~bse a ahri 1 2002.
L i d o ~eserilpei15n
CiF ;L X M82 34.5
Se ut:iliz;xro~i dos estrategii~s para an,ali;:ar las poblaciones F3. En un CiIso, se diseiiaron prime-rs marcados con fluorescc:nc-is para ser utilizados con los primers P'SbP4.36~ o E'SNf3436c para la amplificacion de una s'ecc.encia con uria I:, d.os indels en esa regi6n. Los fragmentos de .PCR fueroln an.aliza,dos con un sisi:err~a Gene Scan para detlerrninar su tamaho; aquellos con uria delec:16n era de, espesara'e fueran nlas cortos po; dos nucleotido:;. Est'o pudo ser corr~probado. Lra - .. -
otra estrz.te;=ia iriclllydl 1;3 secuenciacicir~ d.e 10s fiaginentos tie PCR dc:l :par de primers PSNF'436 sPSPP436c y cali ficar cada secuencia como correspondiente il ti;po-esculc?ntzlm, a 1.ipo- chileme CI hete:ro<:igota. F:ue sunlamente facil identificar 10s genotipos hetei-oc:igotas ya que la secue.ncia se descoml?o~~ia en el 1uga:r exact0 de una indel y :luego se cornponia n-ue\rarrlente en (:1 lugar exac:to de la segunda i11de.l.
T,os res.ultados - obtenidos con 10s piilners m.arr:ados con Iluorescencia (FAM) y las secuemcias n~ues,iran que HC71180, A482 y GI13 tienen genotipos E/E (hon~oc:igc)tas para el tipo esculentzirn, delecion PLA seguida de una insc:rci6n AC). (3hl Cih2 tienen geriotipo ele (homocigota, t;ipo chilenscl, insertion AA seguida de uila deletion AC). Para las planta:; de fenotipo r1:sistente hubo 2, 13 !I 5 plantas en 1as clases E/E, E/c: y ele, respccti.vame:nte. Para las plantas su:~cc:ptrjles, :bubo '7, 5 :y 4 plantas en la clase E/E, E/e y e/e, r~cspectiva.mente. (Zuando se combinarl lo:; d ~ t o s de 10s :Feno-tipos susceptibles y sesisientes (9, 18, 9 plantas pa.ra E/e:, Ele, eie:, respec:tivamente), la segreg.2ci6n se ajusta a una propol-ci6n 1:2:1, la cu.al se esperaria de la seleccion aleatoria de la:; plantas.
hi r - 12 2 :1 AiWLGTTT(;TCCAG.4TTiGTCC'TTflAAGCAG3CA~Z',P3iTACT(;CACCC&\GQGAGT(;AC'ATA 6 0 TY50 W . G T TT(;TG GAG~ZTELGTCC'~T~~UGCAGGCAGM~TACT(;C~~LCCCA~~GGGAST(;ACAT.~ 6 0 HC7880 M~.GTTTC;TGGAG~\1'AGTCC'rTEMSCIiGGC~3AFiTACT(;CE,CCCAIiGGGA~3TC;ACAT,9\ 6 0 TY52 AIiAACiT'TTC;TGGAGilTAG rCCTTPAh3CIiGGCA(;AFf ACTGCP.CCCMiGGGAOTI;ACAT;S 6 0 Glh PJLAAGT'TTC:TGO AGI~T>,GT~C!CTAAAI;CI~GGCA~~M~~ACT(;CE.CC CAIiGGGAGTC;ACATil 6 0 Consensc!:; a~~aagtttgtggag;tta.gt_~ct;taaagcaggcagaa.tactgcacc za;igggagtc_lacata
hir 12 2 3 G'I?TGA','(-'MLTAAAGY~AC.GG.W~A. . CCA'I?GAGGTC?'CG3GTTATT,WiATCT(! AC:TAGA(; 118 TY50 GTTGATCAP,TAAAG:?AGGG.WiA. . CCA'I'GAGGTCT'CGl3GT"ATT;WiATCTOAGTASA(: 118 HC7880 G'I'TGA'l8(ZAP,TAAAGTAGGG.WIA . . CCA'I'GAGG
Glh GTTGATCAATAAAGTAGGC-AAAAaaCCATGAGGTCTCGGGTTATTWTCTGAGTAGAG 120 Consensus gttgatcaataaagtagggaaaa*+ccatgaggtctcgggttattaaaatctgagtagag
hir 1223 TCAAAACCACTAGGTGATTCTCATTTGCACAAGACCCCAAACCTTGGTGGACAGATTTAC 178 TY50 aCAAAACCACTAGGTGATTCTCATTTGCACAAG9CCCCAAACCTTGGTGGACAGATTTAC 178 HC7880 aCAAAACCACTAGGTGATTCTCATTTGCAC~GACCCCAAACCTTGGTGGACAGATTTAC 178 TYS 2 aCAAAACC..TAGGTGATTCTCATTTGCACAAGACCCCAAACCTTGGTGGAcAGATTTAc 178 Glh aCAAAACC..TAGGTGATTCTCATTTGCACAAGACCCCAAACCTTGGTGGACAGATTTAC 17 8 Consensus *caaaacc**taggtga~tctcatttgcacaagaccccaaaccttggtggacagatttac
h i r 1223 CCGGTACCTGTGTTAGTGGGACTTGGGAGGTAGCATGTACTCGATAGMTTAGTCGAGGT 238 TYSO CCGGTACCTGTGTTAGTGGGACTTGGGAGGTAGCATGTACTCGATAGMTTAGTCGAGGT 238 HC7880 CCGGTACCTGTGTTAGTGGGACTTGGGAGGTAGCATGTACTCGATAGAATTAGTCGAGGT 238 TYS2 CCGGTHCCTGTGTTAGTGGGACTTGGGAGGTAGCATGTACTCGATAGMT~~AGTCGAGGT 2 3 8 Glh CCGGTFCCTGTGTTAGTGGGACTTGGGAGGTAGCATGTACTCGATAGAATTAGTCGAGGT 238 Consensus ccggtacctgtgttagtgggacttgggag~tagcatgtactcgatagaattagtcgaggt
Figura 14. Secuencia de un fragment0 de PCR obtenido con el par de primers (PSNF'436sI YSNP436c) para L. hirsutum LA123 y HC7880, variedad de origin cubano susceptible a begomovirus en Guatemala: Glh, linea seleccionada del hibrido FAVI 9 (resistencia a begomovirus derivada de 902h); TY52, isolinea con el gen Ty-1 de S. chilense (Zamir et al. TAG 88: 141-146); TY50, isolinea de TY52, sin el gcn Ty-1 para resistencia a TYLCV.
Por lo tanto, la combinacion de datos no apoyan un ligamiento entre e! fenotipo resistente en las lineas Gh1 y Gh2 y el marcador molecular TG436. Es posible que estas indels puedan ser utilizada como un marcador del gen Ty-1 ya que esthn presentes en TY52 y Gc9.
RFLP - busqueda de marcadores ligados a genes de resistencia a begomovirus en una linea de Guatemala 4
No se detectaror polimorfismos para estas 125 combinaciones de sondas (25) y enzimas de restriccibn (5).
RESISTENCIA A NEMATODOS Y FUSRRIUMRAZA 2
En el Cuadro 11 se presentan 10s resultados obtenidos en varias de las 15neas de mejoramiento resistentes a virosis transmitida por mosca blanca.
AGROCYT 002-2002. lnforme final 3 1 Dr. I.uis Mejia, FAUSAC
Cuadro 1 1. Resir tencia nemitodos Fusurizlm raza 2 detenninada por marcadores moleculares.
----- Gc43-4-3 - 1 I Htb. :on?.
11 Gc43-5-4- a. I (3cB I Hib. clam. 1 + 1 1- 11 11 Gh137-1-L.-1-1 ! Gh;! 1 Hib. corn. 1 .t 1 i- 1 1
I Scolt I Scott
Hi". corn. + HILL corn. 11 BvOO94-1
GhT44.-2- 1 -a-1:F 1 .H&. corn.
Gh 31-4-1-2-1-1 Gh5 nd + ~ 7 1 - G ; ~ - ~ ~ - - - - - $ ~ - - 7 4 - - ~ ~ - ~ - - ~ - - - A ---- ------ ------- ----- Gc171-1-1-1-1 Scotl Scott nd +
---A- ------ ----- ---- - --- ---- 11 LA271 I -a 1 Scot1 1 !',cott 1 nd 1 + 11
Gc43-5-4-1-1-1 1 G I : ~ I i ~ b corn. + + L'. --- I- - - 1 - - - - 11 4-:I-a-1-1 I Fsivi I Favi. 1 nd. 1 + I \ w~hp44- -2- 1 5 1 G:h&O x Ghl 1 Hib corn. +
-= -E -==- lip--
nd A,=- il
--------------------------- - ----- AGROCYT 002-2002. Informe final 32 Dr. Luis Ivlejia IFAIJSAC
Tnei I Progenitor Progenitor Resistencia a I I fea.enino masculine / Nernitodos Fusariutrz raza 2
Gc143-1-1-3-a + Gho44-1-2-2-1-1 1 G h ~ l 0 x Ghl I EIib. corn. +
11 Ghp44.-1-1-TF3-1-1 I GhplO x Ghl I Hib. corn. - 1 - il
DISCUSION La selecci6n .ealizada durante varios ciclos consecutivos ha pennitido la obtencion de
una buena cantidad de lineas estables (F6 o mas). Estas lineas son altamentr: resistentes a la virosis transmitida por mosca blanca (DSI 42) . Estas lineas tienen frutos de d~ferentes formas y tarnafios, desde redondos de 15Og ( como Gh159-1-1-1-t-a y Gh159-1-2-1-a-1) hasta frutos de 40g, tip0 cerezz, (corno Gh187- 1-1 - 1 - 1 -a). La firmeza de 10s frutos sufri6 un cambio drastico, la mayona de las lineas preserta ahora frutos de alta firmeza (P35) de manera contrastante con la situation inicial. Tambien se cuenta con excelentes lineas tipo roma, con frutos finnes de 809, con resistencia derivada de L. chilense (corno Gc 17%; -a- 1 -a-c), de L. hirsutum (corno Gh 183- 1 - 4- 1 - 1 - 1) o de una cornbnacion entre L. hirsutum y L. pimpinelllfolium (como Ghpim44- 1 -TF3- 1 - 2). El otro grupo de lineas son el tipo bloqce o chibola, muy popular en Y~arias regiones del oriente para exportacion a El Salvador, con resistencia derivada de L. chilense (comc Gc43-5-4- 1-1-1) o de L. hirsulum (como Gh23-2-1-a-1- 1 ) . El cru;e de estas lineas produjo varios hibridos de excelente calidad, de2ominados hibridos XA en su primera fase, XB en una ;egunda fase con lineas mas avanzadas y XC en su fase precomercial o comercial.
De 372 hibridos XA evaluados se seleccionaron varios, la mayona de 10s cuales han sido producidos en su versi6n XB, con las lineas progenitoras mSs avanzadas. En la actualidad cinco son 10s considerados XC o en fase de comercializaci6n. Estos son XC271, XC273 (tipo roma o saladette; XC4 y XC339 (tipo bloque o chibola), y XC173 (tipo chibola, indeteminado). Estos hibridos estan siendo evaluados y varias partes del pais y su comportamiento ha sido excelente. 1,os hibridos XC4, XC273 v posiblemente XC339, son 10s que se consideran tienen un mejor. potencial, ya se ha recibido solicitud de plantas por parle dc varios productores y actualmcntc sc hacen 10s preparativos para la producci6n rnasiva de sdzsemilla. Los primeros dos se comercializaritn, bajo el nombre San Miguel y Sun Jerdnimo respectivamente, por Gentropic Seeds (Figura 10).
La busqueda de marcadores moleculares ligados a 10s genes de resistencia, particularmente la resistencia derivada de L. hirsutum, permiti6 demostrar que esta no esta relacionada con genes descritos anteriormente localizados en lcs cromosomas 6 y 11. La busqueda de estos genes en otros sitios del genoma result6 infructuosa. La aplicacion de marcadores ligados a la resistencia nematodos y a Fusarium raza 2 permiti6 detenninar el genotipo de vzrias dc las lineas de mejoramiento. Esta informaci6n es sumamente importante para la comerciali~acion de 10s hibridos. Por ejemplo, la infonnacion molecular indica que 10s hibridos XC4 y XC273 son resistentes z nematodos y a Fusarium raza 2. El genotipo de sus lineas progenitoras Gc173 (N= -IF= +) X GhT44 (+I-) y Gh25 (-I-) X Gc43 (+I+) asi lo indican,
AGROCYT 002-2002. lnforme final 33 Dr. Luis Mejia, FAUSAC
en estos inomentos SE: realiltan pruebas biologicas (inocul~~ci6n de 10s hibridos (car1 10s patogenos) para verilicar este resultadcl.
Uno de 10s logros mas s~gnificativos de este proyecto es la vinculaci6ri con la ernpresa privada. De esta manl2ra lo:; resultiidos de lii investigaclon pueden tentx un impact0 sobre la agricultura n(1ciona1, contribuy~,:.ldo a mejorar la situacibn de 10s productores. Ida generacidn cle empleos clue produce la industrial GI? produc::ion de st:m~lla es otra contribution significativa a la economia national.
Conclusiones > .
1. Se genxaron aproximadamt:nte 50 lin'eas resistentes a virosis transnlitida pol mosca blar~ca: con calificaci6n general alnili,a dl? 813 puntos, de tipo de S i t o rcdondo, bloque o chibola y roma o saladette.
3. Se seleccionaron sei.; hibridos XC, tie 10s cui~les. dcts (XC4 Ir XC273) se es-tin produciendo en cantidades conlerciales y tvaluando en diferentcs localidades.
4. El uso tie S;Ws e irtdels ha ?zrnlitido deinostrar clue la re:iistl~,ncia en las lineas Cih no esti asociada con la misma introgresion que lo:; genes Tyl y 5 2 en el Cromosomn 6 y 11 , respecti\larr~ente.
5. El desarrollo y aplicsci6n tie narca adores molecu1art:s pennitio cietenrlinar el genotipo de varias lineas progt:nilor:ls cle hibridos,.
Recomendacioii es 1. Continuar cc,n el desarrollo de lineas progenitoras para intiroducir la resistenlcia a virosis en
genotipos de alta calidad. C'
2. Continuar la evaluaci6n de lbibrido:; XA. En la actudidad se produce serriilla de alrededor tie 500 nuevos hibndos ).:A 10s cuales sel-an evaluados c'urante el 2006.
3. Utilizar olros ~narcadores moleculares ligados a genes d1e resistencia hasta detenninar el genotipo de las prlncipales linea:; de mejorarniento e lhibridos .XC.
4. Realizar pruebas biol6,gicas (inor:-~laciones) para verificar la resistencia a 10s principales patbgenos del1:ornsl e.
5 . Continuar la tlilsaueda de liga,niento a 10s genes de resislen-,ia de.rivados de L. hirslctum en las lineas d.e n1ejoranie:nto.
--------------------- - ------- AGROCYT 002-2002. Inlor ne final 3 4 Dr. Luis Mejia, FAUSAC
Sitio de internet Detalles e imagine: de las ~arce!as de campo puedcn ser obsewadas en el sitio de internet preparado por D. P. Mauwell:
Publicaciones (Ver Apendice 3)
*. .
Mejia, L., Teni, R.E., Czosnek, H., Vidavski, F., Bettilyon, A., Nakhla, M .K., Maxwell, D.P. 2002. Field evaluation of tomato experimental lines and hybrids for resistance to begornoviruses in Guatemala. Phytopathology 92:S54.
Mejia, L., Teni, R. E, Vidavski, F., Czosnek, H., Lapidot, M., Nakhla, M.K., and Maxwell, D.P. 2005. Evaluation of tomato germplasm and selection of breeding lines for resistance to begomoviruses in Guatemala. Acta Hort. 695: 251-256.
El Mehrach, K., Hatimi, A., Gharsal!ah Chouchane, S, Salus, M.S, Martin C.T., Maxwell, D.P., Mejia, L., Williamson, V.M. and Vidavski, F. 2005. Acta Hort 695:263-270.
Nakhla, M.K., Sorensen, A., Maxwell, D.P., Mejia, L., Ramirez, P. and Karkashian, J.P. 2005. Molecular characterization of tomato-infecting begomoviruses in Central America and development of DN'Z-based detection methods. Acta Hort. 695: 277-288.
AGROCYT 002-2002, lnforme final 3 5 ?r LIJI~ Mejia FA: ISAC
Abguzid, A.M., Polston, J.E., Hiebelt, 13. 1992. 'The nucleotide sequence oi'tomato inottle virus, a new gerniriivirus isolated Fro111 tomato in Floritla. J. (sen. Virol. 73:.3225-3229.
Bellows, 'T.S., .Perring, 'T.hil., Ciill: R.J. (St Hea.drick, D.11. 1994. Descl-iptior~ of'a species of Bemi:;ia (:Homoptera:Aleyrclditlae infesting Nortlh American agriculture. Arm. Entomol. Soc. Am. 87:15)5-206.
Brown, J K. 1994. Current status (of Bemisia labaci as a plant pest anti vlrus vector i , ~ agroecos;i;tems8 worldwide. FA0 Plant Prot. E M . 42:3-3;!.
Brown, J.1:. IIird, J. 1992. Whitefly-transmitted gemii~i-vinlses and ,ass'ociated disorders in the Americas and the Caribbean basin. Plant Djs. '76:.220-2115.
Brown, J.E:., Frohlich, D.R., Rosell, R.C. 1!)95. The sw~,etjootato or silverleaf wlliteflles: Biotypes of Bsmisla ttzbcfci or a species coxnplt:~? Artnu R I ~ v . Evtonzol. 40:5 11-534.
Czosnek, t[. ik I,aterr\)t, 1'4. 1?97. A worldwide sunrey of tomato yellow leaf curl viruses. ~'r.c' /z. Pi.ro1. - 142: 13!)2-I 406.
Friedmanrl, M., Lapidot, M., Co$er~, S., & Pilowsky, M. 1'398. A nov~:l source of resistance to tomato y e l l o ~ ~ leaf xlrl virus exhibiting a s~mptocnless reactioln to viral infectiotl. J . Amer. Soc. Hort. Sci. 123: 1004-1006.
Hanson., P., Bemachi, :D., Green, S.:, Tanksley, S.D., Muniyappa, V., Padmaja, A S . , Chen, I*., Kuo, G., Fang, D., Chen, J. ;!i)OO. h4appin.g a. wild tonnato introgrt:ssion associated wit:h tomato yellow leal' curl v i n ~ s resi,stan~:e in a c;lltivated tomato line. J. Arner. Soc. I'IoIZ. Sci. 1;!5::15-20.
Goodnlan, I.<.h4., 1977. Single-strandecl DNA genome in a whitefl!y-transmitted plant virus. Virology 83: 1'71- 179.
Kaloo, (3. Ck Banerjee, M.K. 1990. Transfer of tomato Maf curl virus resistance Foni Lycopersic~n hirsutum f. glabl-atum to L. esculentum. Plant Bredding 105: 156-159.
Lapidot, M., F~iedm,mri, h$., L.acllrnan, O., Yehezkel, A., Nahon, 15., Cohen, S., Ck Pilowsky, PA. 1997. Compari:;on of resistance 1evr:l to tomato yellow leaf curl virus arnolig commercial cultivars and breeding lines. I'lallt Ilis. 8 1 -1 42-51 428.
Lastra, F:. 1993. 10s gemin:ivi?u.s: i l i l q p p o de fitovirus con caracteristicas espec;a.les. En: Hilje, L. & Arl)olc:tla, 0. (E:ds.). Las 1klosca.s Ellancas (Homoptera: Aleyrlodidae) en ~ h 6 r i c a Cer~tral y El Carib8$. h/lemorias del Taller Ct:nt~-oa:meric;mo y del Ca.ribe s0br.e h4osca:; Blancas. Serie Tkcnica, infolme 'TCcnico No. 205. C'ATIE, Costa R.ic2~. p16-19.
---- AGROCYT 002-2002. Infonne final .3 6 Dr. Luis Mejia, FEtUSAC
Laterrot, H. 1976. Lccalisation chromosomique de 1-2 chez la tornate controlant la resistance au pathotype 2 de Fz~~ariurrz oxysporum f.sp. lycopersici. Arm. Arnelior. Plant 26.485-491. Laterrot, H. 1990. An EEC programme to improve he resistance of the tomato to tomato yellow leaf curl virus. EUCARPIA, Tomato Wor1;ing Group, Synopses XIth meeting, March, 1990, Malaga, Spain. p3 1-36.
Laterrot, H. 1992. Kesistance genitors to tomato yellow leaf curl virus (TYLCV). Tomato Leaf Curl Newsletter 1 :2-4.
Laterrot, H. 1996. Breeding strategies for disease resistance in tomatoes with emphasis on the tropics: current status and research clialle~iges. Proc. 1" Int. Conference on the $rocessiiig Tomato. Nov. 1996, Recife, Brazil. p!26-132.
Latenot, H. & Moretti, A. 1996. Chepertylc lines. Tomato Leaf Curl Newslettcr 8:4.
Martinez, J. 2001. Tcmato markets in Central America. Tomato Breeder's Round Table. Antigua, Guatemala (1 2- 16 de marzo).
Martinez, Y., Quiiio11ez, M., Fonseca, P., Potter, J. & Maxwell, D.P. 2002. First report of tomato yellow leaf curl virus associated with beans. Phaseolus vulgariz, in Cuba. Plant Disease 86:8 14. - Mejia, L., Teni. R. E., Nakhla, M. K., & Maxwell, D. P. 1998. Tomato-infectil~g whitefly- transmitted geminiviruses in Guatemala. 2"d International Workshop on Bemisia and geminiviral diseases. Puerto Rico, June 7- 12, 1998. p. P47.
Mejia, L. 1999. Evaluacion de genotipos de tomate pal-a resistencia a geminivirus transmitidos por mosca blanca y su deteccion por PCR. Informe Final. Proyecto FODECYT 48-97. 52p.
Mejia, L. 2001. Mejoramiento genetic0 del tomate para resistencia a virus gkminis transmitidos por mosca blanca y su deteccion por hibridacion de acidos nucleicos. Informe Final. Proyecto FODECYT 83-99.4 1p.
Mejia, L. 2001a. Resistencia genetica a1 acolochamiento de la hoja para la produccion sostenible del tomate. AgriCultura 4 (41):3 1-33. i'
Mejia, L., Friedmann, M., Lapidot, M., Pilowsky, M., Vidavski, F., Czosnek, H. &Maxwell, D. 200 1. Evaluation of tomato gennplasm resistat to TYLCV for resistance to bipartite whitefly transmitted geminivruses in Guatemala. 41'' Anriual Meeting of the American Phytopathological Society-Caribbean Division (APS-CD). Varadero, Cuba.
Mejia, L., Teni, R,E., Czosnek, H., Vidavski, F., Bettilyon, A., Nakhla, M.K. & Maxwell, D.P. 2002. Field evaluation of tomato experimental lines and hybrids for resistance to begomoviruses in Guatemala. Phytopathology 92:S54.
AGROCYT 002-2002. lnforme final 57 Dr. Luis Mejia, FAUSAC
Mejia., L. 2003. Resi<tenci;l geneuca para la proclucsi6n s'ostl:nible del tomate: production de hibriclos tolerante:; :. virosis transrn~tida por rr~osca blai~ca y t;u evaluacion agron6rnil;a y mo1ec:ula.r. 1nfi3m1e Flnal, 13::oyecto F'OIIEIZY T :11-'00. 5 1p.
Michelmore:, R. Mr., IParan, I., 8t Kesselj, R.. V. 1.931. Identification of markel-:. ].inked to disease resistanc~: genes by hu1k:ed segregant analysis: a rapid method to detect markers in specific: genon~ic regions using segregating populations. l'roc Natl. Acatf. S;ci. U.S.A. 8 8: 9828-9832.
Morales, I;. J . 6' A~derson, 1'. E:. 2001. 'The emergence and clissemination of mrhitefly- transmitt1:d geminiviiuses in La tin Arnei-ica. PLrch. Tlirol. 146:4 15-44] .
Nakhla, ?,I1 .K., tSc I). P. h/la?:~vell. 19518. Epidemiology and nlanagement of torrato yellow 1ee.f curl dl sea se. In Plant Virus Disease Coritrc~l, ed. by A. Hadicli, R. K. IUletarpa,, a , ~ d H. Koganezanva. I'ublished by APS Press . pp.565-5811.
Nakhla, R4. EL., Maxwell, D. P., Martinez, R. T., Carvalho, M. G., & Ciilbert;on, R . L. 1994. Widespread occunen1:e of the E:asterr~ Medite~rarlea~l slrain of tomato yellow leaf curl geminivirus in ton-latoes in the IIo~nir~ican Republic. P la,i t Dis. 78:926.
Navas-Castillo, J., Sanchez-(:acnp~)s, S., Di.az, J.lr., Saenz-Alonso, E dk R/loriorres, E. 1999. Tomato yellow leaf c ~ ~ r l virus-Is causes a novel disease of common bean ant1 severe r:pitlenlic:; ir: tomato in Spain. F'larlt Dis. 8399-32.
Padidam, PX., Sawyer, S. & Fauque:t, (2.hll. 1999. possible emergence on I'ew gerriniviruses by frequent recombination. V ~ I o logy 2'65 :2 1 8-22: .
Pilowsky, 1M. & Cohen, ' S . 15174. Inheritance ofresisl~ance 1.0 tomato yellow leaf curl vinls i:n tomatoes. I'hytopatho:logy 64:632-635.
Pilowsky, IVI. & Cohen, S. 1990. Tolerance to tonlato yellow leaf curl virus derived fiorr~ Lycopersicon peruvianum. Planl. Dis. 74:24:3-250.
Polston, J B., M~;Gove:m, R.J y Brown, I,.G. 1'399. introduction of tomato yt:llow leafc~ul vinls in Florida and innplications i'cs the spread of t h ~ s and o p r ge~nirliviruses in torlato. Plant Elis. 83~984-9881.
Polston, J. E., & Anderson, .Pa K. 199'7. 'The emergence of whitefly-tr;insmiitecl geminiviruses in tomato in the W~zstern Hemisnhere. Plant Dis. 81 : 13 58-1 369.
Ramirez, I' &, Maxwell, .D.P. 1994. G~:rninivinis transmititlos por rnloscas blancas. En: de EAata, M., Dardon, D.E. &; Salguero, V.E. (Eds.) Biologia y mane.jo tie1 complejo m.osc;a blailca-virosis. Memorias tlel 111 Taller Clentroanerica.no y tiel Caribe snbre hlosca Blanca (Guiite~nal a, septiembre:, 1994). 13.95- 108.
----------------- ------------- AGROCYT OCl2-2C'02. Infl3rm'? final 3 8 Dr. Luis hlejia, FAIJSAC
APENDICES
AGROCYT 002-2002. lnforme fi, ,a1 40 Dr. Luis Mejia, FAUSAC
Apendice 1. Bcleta utilizada en la evalilacion de li~ieas e hibricloo.
--------- ----------- ---- ----- -- AGROCYT 062-2002. Inforrne final 4 7 Dr. Luis Mejia FAlJSAC
' Entry Name
I Pedigree - Date
Days after transplanting-
I General Remarks
Apkndice 2. Contrato d e licencia de d~=sarrollo y c3n-~ercializacion de g,errnoplasma elite de tomate entr~: la Un:!versidad de Sail Carlos y Semillas 'Tropic:ale.s, S.A..
-_-_--_- _ ---- -------------- AGROCYT 002.;!00:!. I n f o r ~ e final 4 2 Dr. Luis Meiia, FAUSAC:
CONTRATO DE LICENCIA DE DESARKOLLO Y COMERCIALIZACI~N DE
GEaMOPLASMA ELITE DE TOMATE
En la ciudad de Guatemala, el diecinueve de octubre del aiio dos mil cuatro, comparecemos por
una parte LUIS ALFONSO LEAL MONTERIROSO, de cincuetrta y tres aiios, medico
Veterinario, guatemalteco, estado civil casado, de este domicilio, me identifico coa la cedula de
vecindad numero de orden U guion veintid6s (U-22) y de rygistro sesenta y un mil triscientos . . - -
cuarenta y nueve (61,?49), extendida por el alcalde municipal de Jutiapa, de Departamento de
Jutiapa, actuo en mi calidad de Rector ?or ende Representante Legal de la Universidad de San
Carlos de Guatemala, instituci6n que en lo suczsivo se le denominara "LA UMVERSIDAD",
acredito mi personeria juridica en lo cocducente de las actas: a) de eleccibn y b) de toma de - posesi6n del cargo, de fccha tres (3) y treinta (30) de junio del aiio dos mil dos (2002)
respectivarnente y con lo estipulado en 10s articulos: Veinticinco (25) de la Ley Orgimica de la
Universidad y Trece (1 3) de sus Estatutos, correspondiendole por consiguiente la representaci6n
legal de la misma; seiialo para recibir citaciones y notificaciones, el Edificio de Rectoria, Ciudad
Universitaria, Zona doce, Segundo nivel; por otra parte RICIIARD FREDERICK ROTTER
WINSLOW, de cuarenta y tres aiios, casado, ingenitro agr6nom0, guatemalteco, de este
domicilio. me identifico con la ckdula de vecindad n h e r o de orden A guibn uno (A-1) y de
registro seiscient~s diecisCis mil ochocientos sesenta y kinco (616,865), extendida por el alcalde
municipal de Guatemala, departamento de Gnatemala, actiio en mi calidad de Presidente del
Consejo de Administracibn de la entidad denominada SEMILLAS TROPICALES, SOCEDAD
ANONIMA, lo cud acredito con el acta notarial de mi nombrarniento, autorizado por el dia seis
de mayo del a50 dos mil cuatro, por la notario Carmen Gabriela Mejia Retana, mismo que se
enouentra inscrito en el Registro Mercantil General de la Republics bajo el numero doscientos
veinte mil novecierrtos cuarenta y cuatro (220,944), folio ochocientos ochenta (830) del libro
ciento cuarenta y siete (147) de Auxiliares de Comerciu en adelante llarnada LA EMPRESA,
fieiialando colno lugar para recibir c,~taciones y notifica=iones la Flllca La Amteita carretera a
Jocotenimg;~, Antigua (hatema la, departamento de Saca tepequez. Ambos cleclaramos ser die 1,as
generales esi!puladas, estiu en libre ejercicio de nuestros derechos civiles, que 1:s
repn:!;entaciones ~que se ejercitan son sufi~:ientez a nuertrc~ criteric para la celebriicicm clel pre!;ente
conb-ato, y por este aclicl, otorganlos CONTRATO DE; LICIENCIA X)E DE:SARROILLID 'Y
COMERCIAILWA(;I~~T~ IPE GElUbIOPL4SM.A ELITE DE: i'4)NIATE de conformitiad con
PRIM%RA: ANTECEBIZN'rES Y I)IEFICNICI~N DE TERMINCIS CON'I'RACTUALES
A. D~:c:lara el sekv Ideal IMontel-ros.0, en la calidad son que actlia, que L.9 IINVERSIDAD es
legiti~rra propietaria del {;ermopl,wna :lite de tomate ~de~~tificatio en el Apindioe 1 (documentc~
que ii~rrr~a parte imegral del present{: contrato) el cual ha sido prodwcido Imr la actividad'
investi,gatival del Iloctor 1,ui:; hlejia I>e Letin, Profeoor de la Um~iversiciad de Sim Carlos de
Guatenlala, en calaboracrt6n con (21 Doctor Douglas Paul Prlaxwell de la Uriversidad de
Winsconsin-Madisc~~l, asi t.arn,o la colalmri~cicin tie otras colegas en la materia, mismos que llan
cedido dicho gern~oplas~na elite de tomilte a la Universidad de San Carlos dc Guatemala,
especifi~camente a Ila 1:acultad de Agcrlonna de dicha institucibn educativa cesl6n que se h~zo
mediante ~Jocurnenlo d'e la WrW: (Wisconsin Alumni P-esearch Foundatbn) de recfla tiiecisi1:te
de diciembre del aiio dos rnil tres i1 7 de diciembrc del3003).
B. An~\ws comparc:cic:ntes mimifestamss quc para fac,ilitar la aplicacion y ejecucion de 10s
acuerdos del presente contrato de com6n acue:rd;~ establecemos lo que debe t:ntcnilcrse: >or 10s
siguientes tknninos:
Germolslasma elite: ma~erial vegetal con superioridad genktica c:om~prc~batia.
Lineas: maternal vegetal1 con unis ccnsiituciun genk~ica homog6nea.
Derivatlos: material vegetal :seleccionaido a partir de una poblacibn gen6ticamenie heterog14nea.
Hibridcl: matelrial ve;getil ptcducido por el cruce de dos lineas.
SEGUNDA: DEL OTORGAMIENTO DE LA LICENCLA
A. La UNIVERSIDAD por intermedio de la Facultad de Agronomia por medio de este contrato
confiere a la EMPRESA, con exc!usividad, la licencia de desarrollo y comerc!alizaci6n del
germoplasma elite l e tomate referido en la cl6usula anterior, para qrle en to& la region de Centro
America, Panama y el Caribe, pueda poseer, mantener y utilizar 10s mismos para i:l desarrollo y
comercializ~ci6n de hibridos y para su mejorarniento gedtico. ". . B. Con sujeci6n al cumplimiento de las disposiciones del presente contrato la UNIVERSIDAD
por intennedio de la Facultad de Agronomia otorga a LA EMPRESA autorizacibn expresa, a fin
de que LA EMPRESA acceda y utilice el gennoplasma elite de tomate para su respectiva
comercializaci6n en las regiones geogrhficas antes descritas; asi comc para vender, transferir, -
asignar o proporcionar a quien considere apropiado, el libre acceso a1 producto resultante del uso
del .gemloplasma elite de tomate, en la forma, tiempo, medios y maneras que la EMTRESA
considere convenientes.
TERCERA: CONFLDENCIALIDAD
A. LA EMPRESA declara comprender que el germoplasma elite de tomate es propiedad
confidential de la LWIVEP.SIDAD, y asimismo que contienen secretos industriales y elementos
de propiedad intelectual correspondientes a la UNN~RSIDAD. LA EMPRESA se obliga a
mantener la confidencialidad de dicho germoplasrna elite de tomate.
B. La UNIVERSIDAD por intermedio de la Facultad de Agronomia autoriza expresamente a la
EMPRESA para modificar dicho germoplasma elite de tomate y expresarnente declara que si de
dicha modiiicar.i6n o desarrollo se produjeran nuevos productos o elementos patentables o no,
qUe pudibr% ha& dem11ado sola o junto con terceras personas, dichos productos o elementos
pertenecen con exclusividad a LA EMPRESA.
C. Toth vents se harri constiu a travi:s tle un reporhe de venlas elaborado por la Em,pre,;a,
deb'idamen te (aud itaclo.
D. 'Todo p;-lgo se hara clurzmte 10s priineros treinta dias despuCs; de cada ,aiio vencido, es decir clel
uno a1 treinta de enero de cadi aiio. Dichas conb-aprestaciones 6nicimentt: s e rh pagaclas en el
caso en ique hiaya ventas, de lo t~ntrario la IJNIVERSIDAD no tendri derecho ,a contrapresti~citin
alguna.
S E F ~ T ~ I A : ESTIPIJLAC [ONES ACICIZMIRIAS
A. L.a CTdIVEIRSIDAD por intelmedial de la Fac.ultiid (ie Aponomia er;prt:samente ~nanifiestal que
otorga 1111 periodo de dos mios dle gracia, contados a par-tir de la fecha del presemnte contrato, para
el inicic~ de la coime1~ciali~cci6n de lo!; hibridos derivi~dos del gennoplasma elite tie tomate. Eu -
case que la Empress descontinuara el ~desarrollo o la comercializaci6n del gem~oplasma elite dl-,
tomate idlentificado blajo esta lic,encia por mias de an iiiio calentiario, ~despue:~ de e..;e periodo de
gracia, la UNTVER~IIDPLD por intermedio de la Fiicultacl dt: Agronornia tendrii el derecho a lil
cancelaci6n de la pres;ente licencia, :;in imputilcic~nes recipr-ociis.
B. A1 fin.alizx el periodo de la presenb: licencia, la Empresii deb& devolver o ties1rui:r el
germophsma elite je tomate recibido de la UhW:ERSEIM) por lintennedio de la Fitcultad de:
Agromnomi:a. Las lineas desarrolla6~~ ppor la ESmpresa, son propir:-lrul de 161 mism~a par lo que no
tendrii obligaci6n a.lguna de tlt:volucion a la UMKEItSIQAD. Sin embargo la 3mpresa rnmifiesta
expresaxrcente que la contra,pl-estaci6n del dos For c ie~to (2%) por la1 come:rcii~.lizaci6n de 10s
hibridos derivacios de estas lineas, :;e segrlirii pagando a 1.a Facultad de kgronomiri por tien~po
indefinido.
OCTAVA: C!0:NTRCIWmlAS
Ambas putes ctmtratan~es cc~nvieneni qu.e cualquier conflicto, disputir o reclamaci6n que surja de
o se relacione c.on la aplicacion, interpretacihn, y/c~ cumplimiencto del presente contrato, tarito
durante su vigencir. como a la termination del mismo por cualquier causa, debera ser resuelto
mediante procedimiento de arbitraje de equidad, de conformidad con el Reglamento de la
Comisi6n de Resolucion de Conflictos de la C h a r a de Industria de Guatemala (LA CRECIG),
que se encuentre vigente a1 momento de surgir el conflicto. El Arbitraje sera admiristrado por la
Cornisibn de Resolvci6n de Conflictos de la Cama de Industria de Guatemala (LA CREIG), en la
ciudad de Guatemala, por medio de un tribunal compuesto de uno a tres hrbitros,'nombrado de
conformidat! con el reglamento ya relacionado y el idioma del arbitraje serh el espafiol. El laudo -. . - -
arbitral que se obtenga, seri inimpugnable por las partes y debera ser cumplido de buena fe y sin
demora alguna por las partes. Seiialamos para recibir notifi~aciones, las siguientes direcciones: I)
LA EMPRESA: Finca la Azoteita carretera a Jocotenango, Antigua Guatemala, departamento de
Sacatepequez; 11) LA UN1VERSIDP.D DE SAN CARLOS. FACULTZaD DE AGRONOM~: - Edificio de Rectoria, Ciudad Universitaria, Zona doce, Segundo nivel; aceptando desde ahora
como buenas y bien hechas !as que en dichos lugares se realicen; si catnbiara.de dcmicilio
cualquiera de las partes, deberi dar aviso por escrito a la otra.
NOVENA: ACEPTACION
En la forma estipulada, 10s otorgantes en las calidades con que actuamos, aceptamos todas y cada
una de las cliusulas de este contrato,. haciendo constar que hemos leido lo escrito y bien enterados
:!
de. su contenido, objeto, validez y efectos legales, lo ratificamos y firmamos en dos ejemplares,
uno para cada parte.
En la lziudatl de Guatemala, el diecinueve de octubre ael aiio dos rnil tres, clornls Notario do,y fe
que la firma que antecede es autmti'ca, pol- haber sido puesta el did de hoy cn mi presencia po;r: a.
el seii~sr LlnS ALFOMSO U:AJ, IklONI'ERROSO, quien se identifica con, la cedula de
vecintiad numexo tle ord(:n I1 gu.ibn. veintidhs 01-22) y Jle n:gis:tro sesenta y un mil trescierltos
cu,arenla y nueve (61,349), extendicla 1:or el alc4alde municipal cie .Iutiapa, dte Depiutamento de > -
Ju1:iapa; b. RIC:HARIC) EREDERJCK ROTI'EIT. %'INSLOW, cluien se identifica con la cedula -. - - -
de ve1:indad niune:ro de ordlen A guion ur~o (A-I) y de regiso-o seiscientos dieciskis mil
ochocientos sesenta y cinlco (616,865), extendida por 121 ,alcalde: rnun,icipal de Guatemala,
departiunento de Guatemalit. L,os signatiuios f inan nuevarnente la presente acts de leg,alizacion
APENDICE 3: GERMOPLASMA ELITE 114-h 115-h 116-h 117-h 180~-2-b 200~-1-1 175hc-24 1 77~-2-1 195h-1-2 200~1-2
183h-14 1148h-1 1148h-2 1 148Ah-1 1 149h-1 1150h-1 1150h-2 11 51Ah-1 165h-1-1 122h-1-1 -
188h-1-1 188h-14 176~-1-1 1 76c-1 -a 124h-1-3 124h-14 136h-1-a 137h-1-1 137h-1-3 124h-1-5
175hc-2-1 179c-1-1 189h-1-3 195h-1-1 206hc-2-2 181c-2-b 175hc-2-2
25h-6-1 124h-1-1 124h-1-2 1 26c-1-1 126~-1 -M 136h-1-1 136h-4-1 136h-1-2 1 37h-1-5 25h-2-1-1
137h-1-2 137h-1-4 43c-%-a 15h-1-1 -a 23h-1-1 -a 23h-2-1-a 25h-4-1-1
122h-1-3 160h-1-1 165h-1-a 27hp-5-a 159h-1-1 160h-1-2 168h-1-1
25h-2-1-2 25h-2-1 -a 43c-4-3-a 43c-4-1-3 43c-4-1-2 44hp1-3-a 44hp-1-1 -a
179c-1 -a 181 C-2-2 181~-2-3
--
1-3%- 1 -2 188h-1 -M 189h-1 -a 191 c-1 -a 202h-4-1 206hc-2-b - 133h-1 -a 1 75hc-2-3 181c-2-1 186~-1-1 187h-1-2 187h-14 187h-1-5 189h-1-1 189h-1-2 194h-1-2 194h-l-b 206hc-2-1 207hc-1-1 207hc-1-2
-
187h-1-1 1 78~-1 -t, 178-c-2-a 187h-1-3 194h-1 -a 178c-1-1 180~-2c 182h-3-2 187h-1-1 194h-1-1 206hc-23- - 177c-2-a 178~-2-1 178c-2-2 178~-2-3 181 c-2-a
122h-1-2 159h-1-2 -- 165h-1-2 25h-6a 2 1 h-3-2- 1 21 h-3-2-a 36h-4-1-1 21 h-3-2-2 23h-3 1-a 31 hp-7-1-1 36h-1-1 -a 45hc-1-1 -I 34h-7-1 -a 31 hp4-1-2 31 hp-7-1 -a 43c-5-1 -a 43~-5-4-1 21 h-3-2-3 21 h-3-24 43c-5-1-1 23h-3-1-1 23h-3-1-2 4501 -1 -TF1 47h-1-1-TF1 47h-1-1 -TF2 47h-1-1-1 47h-1-1 -a 1 82h-3-a 180c-2-a 1 88h-I -3 'I 91 C-1 -1 194h-I 3 206hc-2-a 17801 -a 160~-1-1 1 80c-1 -a 1 80~-2-1 18Oc-2-3
31 hp4-1-1 36h-1-1-1 43~-5-1-2 4305-1 -3 43c-54-b 44hp-1-2-2 15h-14-a 43c 2-1-a 44hp-'l-2-a 45hc-2 -1-2 25h-8-1-1 43~-2-1-1 4 3 ~ - 1 -a -
4hp-1-2-1 44hp-1-1-TF3 44hp-1-3-TF1 44hp-1-3-TF2 170c-1 -a 170-1 -1 1 72c-1 -a 1 72~-1-2 105h-1 -a 17361 -a 105h-1-2 105h-1-3 1 80~-2-2 1 82h-3-1 188h-1-2 18811-1-6 188Fa-1 -7 1 88h-1-5 188h-1-8 1 88h-1 -a 1241 1-1 -a 143h-1-1 143h-1-2
I
25h-8-1-2 4304-1 -1
- --
43~-4-3-1 105h-14 172c-2-a 105h-1-a 105h-1-1 .. 17lc-l-SB 171 c-2-1 172~-1-1 172c-2-SB 17202-3
- --
1 72-24 - 17301 -1 . 173c-1-2 1 73c-2-1 173~-2-2 173c-2-a 171c-1-a 105h-1 -TFZ 1 73~-2-TF1 GA-2 44hp-1-3-1 105h-1-TF2
- A.p&ntlice 3. Publicti~ciorles rea.lizadels sobre 10s rssultados obtenidos en el proyec,to.
---------------------- -------- AGROCYT.002.2002. lr~for~ne f~nal 43 Dr. Luis Mejia, F:AU:SAC
programs. These i iicluded different sources of resirtance, from the wild the species L . hirsuturn (Vidavsky and Czosnek, 199X), L. cl~ilense (Scott et al., 1995), L. peruviurz~inz (Friedmann et al., 1998) and L. pir71pir~ell~foli~trn (Laterrot, 1992). The seedlings were started near the trial site in the open field and naturslly exposed to viruliferous whiteflies coming from infected fields. No specific control was used against the vector and fungicides were used for control of foliar pathogens. The seedlings were transplanted in a randomized block design with four replications of ten plants each, at a spacing of 1 x 0.4 m. Symptoms were scored on a Disease Severity Index (DSI) scale of 0-4, in which a score lower than 2 is considered indicative of resistance. DS! scores were recorded at 30 and 60 day; after transplant. Average fruit weights and average yields per plant were recorded at harvest. Resistant p lants were selected individually for several generations until phenotypically hon~ogenous lilies were obtained.
RESULTS . .! - -
Lines with resistance froni L. hirstirurrl (\'idavsky and Czosnek, 1998) were Ghl , Gh3, and Gh13 selected from hybrid Favi 9 and line (3h2 from hybrid Favi 12 (Table 1) . Lines with resistance from L. peruviunut~l (Friedmann et al., 1998) were Gperl 1 selected from breeding line TY 198 and Gperl2 and Gperl9 Som breeding line TY197. Lines with resistance froni L. chilerlse (Scott, 1995) were Gc9 and Gcl6 selected from breeding lines Fla 595-2 and Fla 658-2BK, respectively. Line Gpinip~:rlO was selected from segregating population I'in~per 5 - 1 3 with resistance derived lion1 L. pinlpi~lellzfolilr?~~ and i,. pertrvi~lrii~r~i (Latzrrot, 1992). The susceptible line tic6 was selected from the Cuban
psistant cultivar HC-7880, which is adapted to tropical conditions. Not all TYLCV-re. genotypes tested In Gua~emala had useful levels of resistance to local begoyio-{inrses; lines 'I'Y 52 with resistance derived from L. chilerlse (Zaniir et al., 1994) and 1123 with resistance t'rum .L. iiir~srrturr~ (Kaloo and Banerjee, 1990) were both suscsptible, when grown in the field trial (data not shown).
At 30 days after transplanting, the DSI's for the susceptible line GCC was generally above 3, whereas the DS 1's of the lines with resistance derived froni Irii:~lrt~i~~~, chi1c;lse or perattvinritrrrr were less than 2 (Table 1) . Yleld per plant ranged fron: 148 g for GC6 to 2,3 12 g fnr Cicl6.
The DSI and yield was deteiniined for various hybrids from crosses among resistant parental lines with different sources of resistance genes (Table 2). Ii', all cases, the DSI's were lower and yields substantially greater than the susceptible commercial hybrid Elios. 'Tht, DSI's of the hybrids were similar to those 3f the parents (Table 1 and 3).
Resistant lines with different sources of resistance were crossed with .,usceptible lilies to deterniine doniinance of resistance. The crosses froni Gc9, Gcl6 , Gperl I , 01-
GpimperlO by a susceptible line or hybrid all gave Fl populations that were highly susceptible (data not shown). Only crosses of resisdnt parents with the hirslrrum-derived resistance genes by susceptible lines or hybrids gave F1 populations with DSI's less than 2 at 30 days after transplanting (Table 3).
In order to introd~lce other traits of interest into the begomovirus resistant lilies, crosses were made to susceptible lines carrying some of these traits (Table 3). These traits included primarily resistance to other pathogens and iruit characters, such as the Saladette shape and increased firmness, since around 80% of the tomatoes planted in Guatemala are field grown f i rn~, Saladette types. Breeding lines have been selected from these hybrids based on resistance to begomoviruses, fruit shape, firmness and yield. Sever,,l of these lines, which now have excellent levels of begomovirus-r~sistance combined with cjther desirable traits, Lave been crossed to produce hybrids that are cul~ently being evaluated for commercial production (Table 4). Currently, over 30 breeding lines with hig;i levels of resistance and various fruit sizes and shapes are available as parental lines for development of hybrids for the Guatemalan and Central Anierican markets.
DIS<IUSSIOI\I TYL,C\'-resistant germplasm selzcte'd in Israel with b e g o n l o v i r u : ; - r e ~ i ~ . : ~ ~ ~ ~ j;enes
from either L. hirsutum (Vitlavsk; ancl ('zcsnek, 1998) or L. ,uertrvianttr?z (Friedmann et al., 15'98) showed high levels of' resisi.ance to the bipartite begomovirus-complex ill Guatt:mala. Also the gennplasrn with L. clrile~rse introgress,ions sclet:tetl for rt:sistance i n Florida, USA to both 'TY1,C'V <and ToM[o\/ (Scott et al., 1!)95) were resijtarlt ill Guatc:rnala. T11.i~ was not the case for !ine H!24 selected for resistance to the n1onop;irtite begornovirus Tonzato let!)" ct~t-l . .~ i l -~l~. (Kaloo and E:anl:rjee, 19C,Q), which was susceptible in Guaternala. .4lso, 1:int TY52, which hiis the Ty--l $:en': from L. chiletzse (Z(3cn;r ct al., 1994), was :;usceptible i n Ci~atemiila; ho1weve~-, recent field tests in Israel haw: irldicatcd that tris line is only niodcrntcly ~csis!a~it 1.0 'I'YL(.'V (,da~.a 11ot shown). 'l'hese resu11.s indicat's that it is ~ussibl: to de\,elop l-)reeding lines that are res,istant to 1~0th monop;rti~c and bipartite begorno\/iruses.
Early crosses \vith resistant iines indicated that the Icvel of ;resistance of the liyb~.id co.11d be increased, when resistance gene:; were introduced from both parents. Fnr example, when tlit: parental line P2-I 132 (the parentai line from where Gpin~pzrlO was selected) was c:ro;!;ed to s. susceptible line: ,the hybrid shovred a ;lo\v level of re~~istanc: (DSI :*I: 6 0 d ays a Ster trililsplanting = 2.9, c:ompal-ed to 3 . 1 in. the s usceptibll.: c ontrol). Howewr, .,vhen this same line was crossed to resistant line F6-221 :1 (the part-nta, 1:ne that produced G'n13:\, il. p1,oduced a 11yt.rid with s high level of resista.ncc (IISI - 1.9). Thi,s could not be attrib;ttecl to don~inancl? alonc, since the parental line iP6-221 1 crossed to thc susceptibli: line had a n intermediate levcl of I-1:sistance (DSI = ;!.I) (date ncit sho\\fn). Subsecluent field trails showed that the crosses b e t w e ~ n two resistant lines produced tht: highest levels of res-istance (Table 2 a ~ d 3). Tiles: crosses also indicatcc. that the resista:xe derived from L. /~ir*sutunt was at least par-tially dominant, while that clerivecl from L . piwpir~elliJljli./rn a;ld .L peri~vii2rru:n was more of a recessive nature. The hybrids with a parental line: with resi:,tance derived froni L hirsuttitlz a:; one of the parents \.ere always more resistant (Table 2: and 3). It is suggested ihat ~con~biming sources of resistance froin different wild specic:~ may h a v ~ the advantage of provieling greatlzr durability. Thus: future hybrid!~ wil'! combine begornovirus-resi:;tarice gene:; from L kirszltu~?z and L. clriie~rne, e.g. Gh13 crossed with Gc9 (?'able 3).
The hybrids bt:twe(;n resistant lin-s ancl susceptiblc lines of hiyh ho:-ti:ultural value k.,ave shown high, le.vels of resistance and good yields ('Table 2). Irrlpro.iea'br~:ec',ing lines with high levels of ::esistance i~nd horticultural traits of interest have tleeri selected from these hybrids. The cros:;es aniong these improved resistant lines iire exrnected to result in hybsrids wit:( high resistance to begornoviruses and good qualltie:; fbr the Guatemalan market. Sixty 11vbrids arz currently bein,g evaluated.
ACKNO\1'1 ,It?DCE:M;ENl'S 4.8 'l'hi:; worlc was fu1.1cled by grant:; from the U SAID/CI)R Progri~m (C21-008) ~ . n d
the AGROlCYT Fund o f Ciuateniala ((02-2002) The authors express their appreciation to Drs. M .,I. I-Iavcy a n d J. W . Scott fo l t heir assistance on breeding 1-1 egoniovirus-re:;ist;l~lt tomatoes.
Literature Cited Friedm:mn, WI., Lapidot, FA., Cc)l~eil, S. and Pilo\vsky, M. 1998. A. novel source of
resistance to tomat:o yi:llvw leaf ci!rl virus ('TY'',C'V) exhibiting a symptomless reaction to viral infection. J . A . Soc. t-101-t. Sci. 123: 1004-1007.
Kaloo, C i . and Biinerjee, fk4.K. 1990 T1:an:;fei. of tomato l.eaf curl virus resista~ice from L,ycc)persicoti hir,strti:rr~z f gl,-lbr.ntutn to L. e::cu!etii'ut.~. Plani: Breed. 105: 1 56- 159.
I-aterrot, H. 15192, R1:sistar;ce gei~itors to lo~nato yellow leaf curl virus (TYLCV). Tomato l,eai'rCuri l\lev#slt:tter 1 : 2-4.
Mejia, L.., Ten;, R.E., Czosnzk, H , 'Jid.svski, F.:, Bettilyon, A.:, hfakhla, M.K. and Maxwell, 1) .P. 2 00;!. F i ~ l d evaluation o f tomato ex:pe~:imental lines and hybrids fo r r1:sistanc:e LO Segon~oviruses in Guatemala. Phytopathology 92:S54.
Moralcs, F.J. and A.~derson, P.K. 2001 . 1 h c emer~. -~lce and dissemination of' whitefly- transmitted geminivir~ses in Latin America. Arch. Virol. 146:4 15-441.
Polston, J.E. and Anderson, P.K. 1997. The emergence of whitefly-transmitted geniiniviruses in tomato in the Western Hemisphere. Plant Dis. 81: 1358-1369.
Scott, J.W., Stevens, M.R., Barten, J.H.M. and Serra, C.X. 1995. Introgression of resistance to whitefly-tra~smitted geminiviruses from Lycoper.siron c1,ilcnsc. to tomato. p.357-367. In: D. Gcrling and R.T. Mayer (eds.), Bemisia 1995: Taxononly, Biology, Damage, Control and Management, Intercept, Andover, England.
Vidavsky, F. and Czosnek, 11. 1998. Tomato breed:ng lines resistant and tolerant lo tomato yellow leaf curl virus issued f r ~ m Lycoptclzvico/l hirszitzrn~. Phytcpathology 88:9 10-9 14.
Zamir, D., Ekstein-Michelson, I., Zakay, Y., Navot, N., Zeidan, M., Sarfatti, M., Eshed, Y., Harel, E., Pleban, T., van-Oss, H., Kedar, N., Rabinowitch, H.11. and Cz3snek, I ~ I . 1994. Mapping and introgrcssioli of a tomato y ellow leaf curl virus tolerance gene, T y l . Theor. Appl. Genet. 88: 141-146.
Tables
Table 1 . Syn~ptonl severity and yield of begomovirus-resistant lines evaluated in Guatenlala fiom April to September 2002.
-~ .
Line and source of resistance Average Average Average Average DSI 30 DSI 60 weightlfruit yieldlplant
- -- - G('6 3.2- 3.4 16 148
0 0
Favi 9 and Favi 12 Gh 1 1 .1 1.5 8 1 1,756 Gh13 1 .?. 1.5 9 6 2,03 1 Gh2 1 . ! 1.6 5 8 1,060 TY 197 and TY 198 i! Gper 1 9 1.2 1.7 4 5 1,750 Gper1 1 1.7 2.5 3 8 1,241 Fla 595 and Fla 658 Gc9 1.2 1.8 82 1,742 Gc 16 0.9 1.2 68 2,J12 Pimper 5-13 Gpimper 1 0 --- 2.4 3.2 4 3 3,75
I'able 2 . Pel.I'or~na,~ce of hybrid:; p:-oduced oy crosses between resistant lines (F: :, K) evalual.ed from April to September 20012. -- --A -. - ---A-p-
Hybrid and sollrcc of resistance Average Average Average A .oer.agc 1)Sl 30 1)SI 60 weightlfruit yield/plar~t
0 - Elio:; (Peto Seecl Co.) 1.1 3.3 22 116 L. l!irs~~tz[~7z Gh ' x Gh2 1.3 1 .I1 6.5 1,9483 L. h i.~s1it7~17z x L. peru~!I'u w 1,1177
i';h;l x (;per1 I 1.2 1.0 48 2,121 (3 h2. x (;per 1 :! 1.3 1.6 52! 1,87*7 *., . . - -'
1,. pt?vuviai.ititir x L. pin;pinellif;3li~i1~1 (;per 1 1p x Gpirnper 10 2.1 2.9 3 9 1,193 ($erl2 x (3 imperlg 1.3 1.8 3 9 1 781 -_ L 2
Table 3. Perfomn~ance of hybrid: produced by crl~sst-,s between resistant lines and sus:eptible lines ( R x S) evaluated fro,n April to Septeni1)er 2002.
H[yb.r id and source of resistance jiverage Average Average Average - DSI 30 I)SI 60 w2ightIfruit yield/plant
. >L A)-- Mlarii~s (Sakata Seed Co.) 3 1 3.3 15 136 Favi 9 (L , . h irsuttr nl) Ghl ;( M82 G , I ~ 1. V t ~ y Fir nl GI11 >. H('-7880 GI13 x Sun Coast GI13 x Rodade Favi I ;! (L. hirslr+~im) G112 x A482 Gh2 x !Sun Coast Gh2 x I-IC-7380
Table 4. S gmmPtoi~ sevc:rity and partial :yie:d of tlegoA,vi;:L,s..resistant hybritls evaluated fron-I Dece~nber 2003 to April 2004.
- ------- Hyibrid Average Average Avera.ge Average
DSI 30 DS.1 50 weight/irru.it yieldlplant (ID) 0 - - L--
Gh3 x s;\~scep;tible 1.2 1.7 5 9 1 ,!)9 7 Gc9 x 7h4.7- 1 ' 1.1 1.6 '7 1 1,277 Gh 13 x 73-47- I 1 .O 1.5 9 5 1 ,?62 Gh 13 x Gc'J 1 .O 1 5 137 1,973 Elios (F'eto Seed Co.) :2.1 3.0 21 1 602 Marina (Saliata Seecl Co.) 2.4 2.0 27 596 Silveraclo (ferry-Morse Seed Co.) 2.3 2.9 21 9 455 Sheriff - ('Ferry-Morse Scled C:o.) :!,3 3.1 20 446
' ~ e s i s t a n t l i ne selectecl frcm a hyl~r id betweell a l ine selected from Favi 9 and a susceptible line
PCR-Based Mcthods for Tagging the Mi-I Locus for Resistance to Root- Knot Nematode in Begomovirus-Resistant Tomato Germplasm
K. El Mehrach and A . Hatirni S. Gharsa!lah Chouchane, M.S. Salus, lbn Zohr Univers~ty C.T. Martin and D.P. Maxwell Agadir University of Wisconsin-Madison Morocco USA
L. Mejia Universidad de Sdn Carlos Guatemala
V.M. Williamson University of California-Davis USA
F. Vidavski The Hebrew University of Serusalem -. - Israel
Keywords: Ly~ope/-sicol~ cvctllelillrlll, Mrloitlogync species, Mi-I locus, RE."-/ locus. Mi-1.2 Sene, polynlerase chain reaction
Abstract Thc begonlovirus-resistant breeding lines being developed in Guatemala were
tested for tile CAPS markers, REX-I and Cor-Mi, that are linked to the Mi-] locus for root-knot t~ematode resistance. Both markers gave false positive results for several breeding lines that are susceptible to M. incognita and have L. hirsutunz (line Ih902) or L. chilense (line TY52) introgressions. SNPs and indels specific to introgressions from two wild species, L. peruvianclm and L. chilense, are described for the t w o CAPS markers. A multiplex P CR was d eveloped, which invdlved t he REX primers and PCR primers (PM3FblPM3Rb) specific for the region 3' of the Mi-1.2 gene. Every plant DNA tested gave a 720-bp fragment for the REX primers, but only those plants with the Mi-1.2 gene gTve a SOU-bp fragment with the YM3FblPM3Rb primers. S i ~ ~ c e this m ultiplex P CR could not d etect hetel ozygous genotypes for the Mi-1.2 gene, another PCR method was used with, prinlers (PMiF3/PMiR3), which gave unique fragment sizes for the Le-Mi-I locus, the Lp-Mi- I locus and the LC-Mi-] locus, as well as with the begornovirus-resistant line with the Il1902-Mi-1-locus. These two PCR protocols will have application in breeding programs in which parental lines have given false positives with the REX-1 and Cor- Mi markers, i.e., especially those using parental lines with begornovirus-resistance genes introgressed into chromosome 6s.
INTRODUCTlON i:
Resistance to root-knot nematode (RKN, Meloidogyne spp.) in Lycopersicolr ~sculetztttnz is controlled by a single dominant gene, Mi-I at the Mi-1 locus, which was introgressed from the wild species L. peruvianum (Smith, 1944). The Mi-I locus is linked to RFLP markers on chromoson~e 6 s (110 et al., 1992); and the functional gene, Mi-1.2, has been sequenced (Milligan et al., 1998). Recently, Seah et al. (2004) reported that there are seven h omologs o f t he Mi gene arranged i n clusters o f t hree (cluster 1 p) and four (cluster 2p) homologs in the res~stant cultivar Motelle [L peruvianttrrz (Lp) introgression]. The Mi-1.2 gene is in cluster lp. in the susceptible cultivar Moneymaker [L. r.~culrntt~trz (Le)] a similar arrangement of the seven homologs (cluster l e and cluster 2e) exists. One difference between the o rgani~ation o f the Mi-] 1 ocus in Lp and Le i s that the 300-kb region between the two clusters is inverted in Lr. Two additional homologs in Le were mapped to chromosome 5 . Other genes for disease resistance have been mapped to the chromoson~e 6S (see Pan et al., 2000; Zhang et al., 2002), e.g., Ty-l gene for resistance to Toniuro yeilo~ * leaf curl virtls in line TY52 (Zamir et al., 1994).
Mal-ker-assisted selection offers the advantage of tagging resistance genes without
Proc. I st IS on Tomato Diseases Eds. M.T. Momol. P. li and J.B. Jones Acta Hort 695 ISHS 2005
. . 3lological assay: l'wo codon~inaiit CAPS (C'leavage 4rrplifiecl Polymoiphic Sequence) !iiark.er:; for detrction of the 'Mi-1 l ' xus have been developed. Williamson et al. (;$94,1 repol-ted the REX- 1 marker (PCR. primers, F.EX-F I /RE>:-R2); and Tanks.,ey et al. r:coni:nct C ornell U.niv. .F o~.rndation, Ithaca, I\; Y) dcvelopzd anotht:r, the Cor-Eili rn arkel- I(PCF: primer:;, Ccr-F 1 /C:or--R2j.
Thz objectives c~f tlnis research were: i) to (:valuate the RE:X ancl Cor-,Mi CAPS, inark.ers for tagg;ing the M;-1 locus in begornovirus-resistant rolnato gemnplssrn that had. .;ntrogression:; fc11 begornovirus resistance from L. chileuse (,LC, Zamir et al., 1094) or L. ~ ' z i r s t j t u ~ ~ ~ (Vida1i;k:y and Czosnek, 1!)96), and i i ) t c ~ clevelop alteinaiive P,CR-based methods for tagging Lhs Mi-l lo~:us, if necessary. l 'he begclmo:irus-res..stant germplasrn is cunently bei~ig evaluat~:d for rc:.;istancc to bcgomovi~.i~scs ill Morocco and I i~~a le~na la (:Mqia 1st al., 2005); ancl the e:~pectatioli is that these PCR-ba.secl methods tor tagging the ,Mi-/ locus will allow tk.e developmenl of breeding lines with I-csistance both to I>egornc~viruses and roclt-knot nematode,
IMA TE RI AILS ANID R/IETHODS 'The known RKN--resistant cultivars with introgressions of the Mi-I l6:lcus were
IVIolclle and Anahu; and susceptible cultivars were Iv[oneyrnak.er, M82: and TJ'50 (,supplic:d 13y H. Czosnek). Comnier~sial cultivars: designated N for RE(Lbl resista.nce were l3etler Boy (V1, F l , N, ASC, St.), Marina (V1, F1, F2, h, A X , St., 13s race 0), Sheril'f (V, F i , F2, hl) and Dcn~in.!quc ('4, I T 1 , F2, TMV, N). Begornovirus-resistant gurinpliism \wit11 intro,gre.;sions frorn 1. c~l~ilc~l~.sc~ \yere IY 52 (Zaiiii! el: al., '1 994; suppl ::a by H . (Zzosnek) ant1 Gc9 (h1t:jia et al., 2005). Also, begorno~i'rus-r~:sis;tant gern~pl.asnl diitli
intro;%ressions frc,m L. hir:;~1tzlm were IhSl02 (listed hs 902 in Vidacsky ai2d Czosnek, .99;3), and Gln13 artd (3h2 (br~:ediq lines selected in (3uz.temala from a hybric' of Ih!)02 t)y t~egomovirus-susceptible lines? Mejia et al., 2005:).
Root-knot nematode bi'oassays with Meloido~yytie i:lcognilu were perfi~mled at the IJni.,iersity of Californi,a-Davis an'd a,: The Hetlrew Lniversity of Jenlsalerr~ usinp standard protocols.
DNA was cxtra8:tetl from fresh leaves from plants grown in a plant g;ro\vth chamber a\: the Unicersity of Mrisconsin. Madison. Thirty rr~g of tissue was frozen in liquid nitroger~ in a microf'uge tube, then grou1;d wit11 a sterili'zed KontesTM n-~icropestle (Kontes Glass, \'ineland, NJ), and e.utracted with the PLJREGEhlEG3 DNA, Purifica1:iori Klt ((3entra Systems, Inc., .Minneapolis, M.N) fo!lowing the manufacturer's instructions. DNA c:onc:entrati.on:; were adjusted to 10 ng/l~l sind extracts frozen at -20°C. All I'CR primers were purchased f'rorn Iiltegratesd DNA Technologies, In(:., Coralville, I L i . F'CR parameters were for 50-p1 reactions coi.itainir~g 5 pl 2.5 nlM deox)nucleotid8e triphosphal.es (dbJTPs), 5 p1 1 Ox blnfft:r, 5 p1 25 mh/I htgC:I2, 0.;'. p1 T c ! ~ IIN.4 polymerase, 5 p1, each forwal-d and rever,ie serise primer a1 10 pMI, 5-7 111 of IINA exvact, and I:lzO. PCF. c;/cli: paraiueters for fi.agiuenl a.mplification \yere as follows: denaturation at 94°C for 3 rnin, then 35 cycles 514°C for 3'0 sec, annealing at 50 or 53°C for 1 min, and ex.ten~sion at 72°C for 1 rnin. These cycles were f'ollo\uecl by a reaction at r'2"Cfbr I0 :nirt, and then the reaction was held at 4,"C'. 1'C1< rt:actions we:!.e pe-rfor11ie:d in the MJ DNA .Enl;inc I'T2.00 l'herino;yclerrM (MJ Rcsearcli IIII:., Waltliani, MA). A!l n-~olccular lbiolog,y clheniicals for t-'CK. were purchased from Pronega, Corp., Madison, MU. PC1R-amplified fragments were sepamted by gel electrophoresi:; using 1.5'1/0 Seiakem LE.T.M agarose (BioWhittaker r\Aol~:lsular Applicati9ns Rockland, ME) .in 0.5X TBE buf'fer, stained with ethidiuni k'roniide, and visualized with a K.odak Gel Logic 200 lmaging Systern. .PCR fragments were directiy sequ'enced using Big Ilye Sequencin,g I<itl:M (Biotcchnology C'enter, b4adi:jo1-1, \YI). Analysis of the salliple seql.lences wiis accomplishecl by comparison with knoivn DNA sequences tl- rough the lvational Cente:r f i ~ r Biotechno1oj;y 111fbrnlation E)LP,!;?' program and tk.e DldAMAN softv~are (Ljrnn~on ~Colp., Quebec, 1Canada).
RESULI'S ANli DISCUSSION
Tagging the Mi-l Locus in Control Cultivars As expected, the same size PCR fragment (720 bp) was obtained with the REX
primers for Motelle, an ah^^. Moncymaker, Retter Roy, Sheriff, Dominique, TY52, Gh2, Ghl3 and lh902. Rather than digest thzse fragments with the 7 i q l restriction nuclease to detect the CAPS niarker, each PCR fragment was sequenced to detect the single nucleotide polymorphism [SNP) associated ~ ~ i t h the TuqI restriction site (TCGA) for Lp and to determine if there were other sequence differences. The SNP (AIC) associated with the REX-1 marker for Le is nt C. The PCR fragment for the resistance REX-1 marker will digest with TaqI restriction nuclease (SNP A) to give fragments of 570 and 160 bp, whereas there is no TaqI site (SNP C) in the PCR fragment from Le. The SNP nucleotide (nt) A for the Lp introgression was present in the PCR fragment from Motelle (AY589502), Analiu, TY52, Gh2, and 111902; and the SNP nt C was present at this .. - - position in the susceptible cultivars, Moneymaker, Gh13, TY50, and M82 (AY596779). The Gh2 line was resistant to M. incognitu and also to the bipartite begomovirus complex in Guatemala. Since the begoniovii-us-resistant lines TY52 and Ih902 were found to be susceptible to M . incognita, t lie S NP nt A a ssociated with the Taq l site o f t he REX-I marker gave false positives for these two lines.
The sequences of the REX fragments from the cultivars and lines were analyzed for the presf:nce of additional SNPs. Each RE,X f ra~ment was directly sequenced using the REXR2 primer and about 600 nt were obtained. In this 600-nt region the RKN- susceptible lines, QIi13, TYSG, M82, and Moneyniaker, had identical sequences, and the three RKN-resistznt lines, Motelle, Anahu, and Gh2, had different but identical sequences. Ten SNPs between the susceptible line M82 (AY596779) and resistant cultivar Motelle (AY589502), AIC, GIT, AIG, AIG, AIG, AIC, TIA, AIG, CIT and CIA, were identifies at nt 18, 33, 63, 100, 138, 235, 279, 489, 522, and 549, respe~tively. SNP positions are based 011 the ut number for REX squence for M82. The RKN-susceptible breeding line Ih902 had the same senuence for this region as Motelle, so there is a pert~viarltlnl-like sequence in the REX-I locus in Ih902. The sequence for TY52, which has an introgr~ssion from L. cllilerrse in the REX-I iocus region (Zamir et al., 1994), had two TayI restriction sites, w h i ~ h could be used to distinguish it from the Lp-REX-1 region that only has one TayI restriction site. When compare6 with M82, TY52 and Motelle had the same SNPs at nt 33, 100, 138, 235, 489 and 549, and TY52 had unique SNPs, TIC;, AIC and CIG, at nt 145, 3 19, and 559, respectively. Thus, three types of sequences could be recognized by the unique SNPc for the REX-1 Iccus, i.e. Le-REX-I (M82), Lp-Hex-l (Motelle), and LC-REX- 1 (TY 52).
It was suspec~cd that tlic commel.cia1 hybrids, I3ettcr Boy, Marina, and 1')ominiquc. would be hete~.ozygous lor the Mi-1 gene (Milmi). Sequence analysis of the REX-PCI< fragment indicat~d that all ten SNPs that are associ&ed with differences between Lp and Le for the REX- 1 locus were present. Thus, these three cultivars are heterozygous for the Mi gene (Mi/r~zi) and have the SNPs associated with the Lp- and Le-REX-,' locus for chromosonie 6 s .
Since tht begomovirus-resistant line Ih902 is a main source of resistance for the begoniovirus-re-istant breeding programs in Ciuaten~ala and Morocco, the REX- 1 marker, which gives a false positive, could not be used in a marker-assisted selection yogram. A second CAPS marker, the Cor-Mi, was then tested. Since the information about this marker is protected by an intellectual property agreement with the Cornell University Foundation, Ithaza, NY, only general results are provided (Jata not shown). This CAPS niarker also gave the expected results with the RKN-susceptible cultivars K~neymaker and M82 and with the RKN-resistant cultivars, Motelle and Anah~l. i-Iowever, false positive results were obtained with RKN-susceptible lines TY52 and Ih902, i.e., these two lines had the same CAPS marker as Motelle, and thus, they should be resistant to RKlV.
1)evelopment of PCIli-based l'vlethods for Tagging thc /Mi-1 I.,ocus Since both the REX-I and Cor-P;li I X P S niarkt:rs ;save falst: positive results with
tile begl~movirus-resistant breeding lines TE'52 ( 2 ) - I gene) and Ih1302:, sevt:ral PIZR primers were designed by comparing the sequence c~f thc promoter region for the Mi-1.2 gene ~(rnRhfP sequence, .4F03982., Mil1i:gan et al., 1993) and the :!,OOO-bp I-eg:ion 3' of [he hli-1.2 gene vvith the 5equc:ncl:s of the Mi-I. 1 gene (mRI\TA sequt:nct:, fiF039681) and those of the gtnomic: DYUA for this re2io.n (lJ81378).
One se t o f 1" rin.~ers, P h4i12Fi. ( 5 ' (3C.4 A T'T C'TA GAT CTA G CT AT'I' 'I'(3T l G T 'TC 3 ' ) and Phlil;!I<2 (5' CC'T GC1' CG'T TTA CCA TTA CTT TTC: CAA C.1: 3'), mras deslgned using the difi!ert:ncc:s between the secluences of the ~~~~~~~~~~s. f i ~ r Mi-1.2 and Mi-!'.I gencs (IvIilligan et al., 1908). PCR with these prinier-s gave single 620-bp and 7 20-l,p ti-a~:nit:ntc; with h401-1eyliialcer end Rlot,:lle, respectively, iind two bands (620 and 720 bp) for the RKN resi,;taat, hetero-.,ygou; cultival.~, Better Boy and Marina. The sc:quenct: of the 152O-bp fragment (A.Yi'291569) from hloneyinak.er co;rrespol~ded to the ._ - ~ - -
c1ust1:r le , ancl that of lhe 520.-bp fragmenl: from M'otelle (A7f7:!9670) to the cluster 2p (Seah and Williamson, unpubiished). With TY52, which hiis he TI,-1 gene from L. ci~ile,zse in this rt:gion (Zam.ir et 31., 195)4), the PCR fi'igment was 1,0130 bp. The lh902 fragn11:nt was '720 bp, an inciics.tioii of the 1.p-iMi-1 locus sequence; l:hus, this prime:? pair gave false positil,6 resilts with the Ih!)02 line. This primel- pair collld be ~t:;ed in a breeding program where the RKN-resistant line has the Lp--MI-/ locus and the otlier breeding line has .!he Lel14i- I Iclcu:;, since this prir,ler pair will dell-ct the homoz>gou; and hc:terl~zygous genotype:; for the ,'Mi-/ locus without digestion with Tilql restriction er!donuclease. Also-this 1)rirlier pair can detect a cl~ilr~r.~c-like introgl-esriol-I in this region as intlica:cd by thi.. I.c'sLI~~:; w it11 l'Y52; and a similar 1,000-bp fragment was obta;lied with C;8:9. a b~:gci~iiovirus-resi:;tzir,t breeding linc sclcctcd in i;ui~tcrnala, \vliich hacl resis~.arii:c from L.. chilet~.se lLA2779 ( I . W . Scl.)tt, pers. ~:onirn~.ln.'~. '1 he HEX-I' locus [?)I- line (.jc9 had the SA Ps Sol. 11-IC Lc*-l'<LjL.l locus, liirLIier evidencc of an introgression in this relion fro'ii L. c / I I ~ , ~ wse.
The PCR prinier pair, PIvl3 F (5' C:CT GTG ATG AGA TTC (ZTC 1'1A G 3') artd PM3I1 (5' ACC C'TT TGI' TGA GCG ACT 'TTG (:A(; C' 3'), was designed to ai;lplif,y the 3' region of the Mi-l.:? gene, and these prirners gavt: a 750-bp fragmc:iit for RKN- susceptible breeding line Gh13, which is resistant to the 5eg, l~n~ov~ruses in Guatemala (Ivlejh et a]., :>-005), ard has 1.1le Le-REY-I IOCLIS sequence: This PCK fraj;mcnt was sequenced ((GenBank 657582) and 593 bp com,pared wilh the similar region iLr the Mi- I.,! gene from the genornic sequence (U81378). Sirce: there were several lnrge gaps between these two sequences, a PCR prirner pair, F'MIIFb (5 ' C.4C ACA TGA GGT ATG T1'C {CiTA 1'TA TGG 3') and I'M3Rt) (5' TCA CAC; C:CT AGC. TT1' TGA .4TC ACT A(?C 3'), was clesigncad 1.0 m;ltch only the: sequence fc~r this region 3' of the: Mi-1.2 gene. Th.ese pri:mers should arrg~lifii a 500-bp fragment only.;when thr: Lp-Mi-1 locus is pre:;ent. This primer pair gave a 500-bp fragment only with h a h u (Mi/Mi), Dolniniq~~e (Mi/t?zi), Sheriff' (A/li/nzi) an.d not with h:oncyrnak:er (nzi/nz,O, TY52 ( 7 j ) - / f l y - . I ) , and lh902 (Lp- REX-; locuslLp-REX-I loci.is). Thc sequent;: of the 500-bp fragment for Anahu (AY73 1505) had 100c,% n t identiy vvitti thc region 3' uf Mi-1.2 gene, and the sequencts of this frsgrr~ent for Sheriff and Dcniinique had 100%) nt idl=nt.ity with that of Anahr.'. Since no PCFt fragments were detected in the Le-Mi-!' locus plants, a multiplex [email protected] 115ed wi~:h the :REX p~imel- pair and PIv13FbIPM3Rl). In this c&:;e, all plants gave a 720-bp fiagm12:nt for the K.EX pri-mzl- pair, and only the plani;s with the Lp-Edi- I locus gave t h ~ adtlitional 500-bp tiag;nc:n t (Fig. 1). The l'M3Fb/P;U3Rb pair did not give false 'positives wi1.h T'Y52 and lh902 (no 500-bp fragments), but this primel- pair did not tiistinguisli betwet:], homozygous and heterozygous g~:notypes for the: Lp-Mi-] locus: e.1: L>on~in:~qul: anti Sheriff.
Since it is essential to distinguish homo?ygous and heterozygous Adi-1 locus plants in a b::eeding program, additional I'CR primer pairs were t:valuated for the region 3'of Mi--].; gene ancl thc pron~oter region of the Adz-1.2 gene. The primer pair,s designed from the Le secluencc: corrcspo~idi~lg 1.0 this region 3' of the A4i- 1.2 gave the sa:me siz,e PCF:
fragment i'or Moileyniaker- (~ui/llli) and Anahu (MiiMi). l'hus, several PCR primer pairs were designed using the Le sequence (AY729669) for Moneymaker fnr the promoter region obtained with primers PMi 12FlIPM12R2, which corresponded to the zluster 1 e. The PCR primer pair, Ph4iF3 (5' GGT A TG AGC ATG C7TT AAT CAG AGC TCT C 3') and PMiR3 (5' CCT ACA AGA AA'f TAT 'I'G7' G(:C; 'I'G'1' GAA 7'G 3'), gave a single unique 350-bp frag lent for Moneymakcr, 550-bp fragment for Anahu, and for the heterozygous cultivars, L\ominique and Sheriff, two frag~i~ents, 350 bp and 550 bp. The sequence o f t he 350-bp Fragment from M oncymakcr had 100'% nt identity w ith the L. esculentuln sequence, which was used to design the primers. The sequence of the 550-bp fragment from Anahu (AY73 1506) was subjected to a BLAST search ot GenBank, and a 94% nt identity was obtained for a 361-nt region (nt I 1 1 to 472) with the promoter region of the Mi-1.2 gene (U65668). The begomovirus-resistant cultivars, TY52 and Ih302, had unique patterns with this primer pair. TY52 had fragments a t 3 50 b p and 7Ci0 b p.. and Ih902 had fragments at 550 bp, 700 bp and 800 bp (Fir. 2). This primer pair distinguished _. _. . . among the Lp-Mi-1 locus introgression in A.lahu, the introgression in TY52 for I,. chilense, and the introgression in lh902.
Two-step PCH Protocol for Detecting the Lp-Mi-1 1,ocus in Begomovirus-resistant Germplasm
Since Ih902 was to be used as a source of begoniovirus resistance in crosses with a RKN-resistant (Mi-1.2/Mi-1.2) tomato line f ~ r the breeding programs in Morocco and Guatemala, the possibility of using two PCR reactions to evaluate the progeny from this cross was exan~ine_d. Two heterozygous genotypes for this Mi-1 locus were simulated. The heterozygous plant (LP-Mi-l/IIz90-3-Mi-I) was achieved by mixing equal amounts of DNA. from Moneymaker (LC-Mi-I, begomovirus-susceptible, RKN-susceptible) with Ih902 ( I11!)0?-Mi- I , b egoi i~ovir i~~-res is ta~~t , RKN-susceptible), and for the heterozygous plant (Lp-!Mi- 1/1/190_7- Mi- I), DNA from Anahu ( I D-Mi- I , begomovirus-susceptible, RKN-resistant) was mixed with that from Ih902. The first step was the multiplex PCR with the REX and PM3FblPM3Rb primers at annealing temperature of 53°C (Fig. 3). As expected, the \unique 500-bp fragment for the Lp-h;i-l locus was detected only with Anahu and the simulated heterozygous plant with DNA of Anahu aild Ih902; no 500-bp fragment was detected with Moneyniaker, h902, or the simulated plant with DNA of Moneymaker and Ih902. The 720-bp REX fragment was detected with all four plant DNAs. Thus, this multiplex PCR clearly detected the presence of the Lp-Mi-1 locus, but could not be used to distinguish between heterozygous and l~orrozygous plants for the Mi- l locus. The heterozygous plants (LC-Mi-IIIl1902-Mi, Lp-Mi-IILe-Mi-l, Lp-Mi-lIIIz902- Mi-I) were detected by a second PCR that used the PMiF31PMiK3 primer pair at a n annealing temperatirrc of 53"C, wliicli woald detect tlic i~niqire fragment sizes for Le-Mi-1 locus, Lp-Mi-/ loci,s and IIIYOZ-.bli-I locus. The PCR fragment sizes were 350 by and 550 bp for Moncyriaker and Analiir, respectively, arid for Ih902, four fragrrents were detected, 5 50, 7 00, 7 50, and 8 00 b p. A s expected For the L e-Mi-1 b y 111902 simulated plant, the fragment for Moneyniaker plus the fragments for Ih902 were evident. For the simulated h eterozqgous plant (Lp-Mi-l/lh902-Mi-I), only the lh902-Mi- I locus pattern was evident, and this is because the 550 bp for Anahu is obscured by the similar fragnleiit from Ih902. The importance of +his second PCR is that it detects those plants that have the three unique PCR-fragment pattenis for heterozygous plants, Lp-Mi-1,'Le-Mi-1 (RKN- resistant), Lp-MI-llIh902-Mi-1 (RKN-resistant), and Le-Mi-IlIh902-Mi-I (RKN- susceptible) (Fig. ? and 4).
This two-step PCR protocol can be used in a 5reeding program involving Th902 (begomovirus resistance) and p arents w ith RKN resistance (Lp-Mi-1 1 ocus), since they will detect the Lp-Mi-1 locus and also distinguish among the heterozygous progenies. It is expected that this iwo-step PCR protocol will also have application in breeding programs in which introgressious in the Mi-1 locus from wild tomato species, e.g., L. chilrtlsr, are used in crosses with RKN-resisthnt breeding lines. In addition, the PCR priiners (PM3FbIPM3Rb) that are specific Tor- the Lp-Mi-I locus anneal within 1,000 bp ofthe Mi-
1.2 gt:nr for root-knot 1it:rn;itotle ~.csistaiice; thus, they are tightly linked to the '~~nctional rN=sistanc:e gene.
P L C ~ ~ C N O M ' I , I ~ D ' ~ E M ~ ~ ~ V T S l'hi:; research was supp'xted I>y s MEF:C/USAID grant 110. (3E(3-G-OO-9:2-00003-
00, ;. C1)R'USAID grant no. TA-.MC)U-01 -C2 1-008. and the College of A.gricultura1 and I.ife !;cienccs, I Jnivcrsily (\I' %'iscor>:;in-Mi~diso~~. A1.111101-s npprc~;ialc hclplirl discu!;sic~ns with Ilr. M.J . .I-lavey, USI.)A. al:d 1 Ini.i.er,;ity of Wisconsin-rdaclison.
Litel-atu~re Ci led tlo, .I.-Y., \Veide, R., M a , H.M., VJordragen, hl.F., Lanibert, K.N., Koonineef; M., Zabel,
P. and Williamson, V.1vl. i992. The root-knot nematode resistance gene (Mi) in tomato: Constn~ction o:F a m'oleculi~r linkage map and identitication of clominant c DN.4 rnarkers in resl stant genotypes. Pllant: J. 2:97 1 -982. -..
hIeji3, L., Teni, K.E., Viclav:jki, F.: C;:osmek, H., Lapidol, M., Nak-hla, M.K. and Mar:we:ll, C1.P. 2005 Evaluation of tomato gerrnplasnn a.nd selec~;ior~ of breeding lines for resistance to begvn~oviruses in Guatemala. .4cl.a Hcrl.. 695::25 1-256.
Milliean, S.B.., Bodeau, .I., Yaghoobi, J. , K-aloshian, I., Zabel, P , artd 'vl7illia1nson, V.Ivl. 1998. The root ic not n ~,~natodc:-resis1:ance ;Sene A4i from tomato i s a r n ernber o f t he 1e.ucine zipper, nucle3tide binding, ieucine-rich r-peat family of plar~t genes. Plant Cell 10: 1307-1 3 19.
Pan, C)., Liu, Y.-S., Budai-Hadl-ial:., O., Sela., M., C'armel-Goren, .L., Zalnir, D , and I;lul~r, R . 2000 Compa_r;iti\e genetics of nucleotide binding site-leucine rich repeat rt:sistan':e gene hc~nic~lo~;ue:; in the genomes of two dicotvledons: tomato ancl Arat~idopsis. Genetics lS5:3O9-322.
Seah. S., Yhghoobi, J . , Rcssi, M., Gleason, C.A. and Williarnsc'n, V.I\/l. 2004. The i~ematoc~e-resi:;tarlce gene, A 4 i - I , is associat1:d .with an invertecl cf~rorno:;on~al segment in jus.ceptil-~le ~:oniparc:d to resistant tomato. Theor. Appl. Genet. 108 : 1635- 1642.
S~ni t l~ , P.G. 19.44. Znibr,)io a-llture of i3 tomato :species hybrid. Pro(:. Amer. Soc:. 5lort. Sci. 44:413-416
Vidav:;kq., F. and (?zc~snc:k., H . 1908. Tomato breeding lings ~reslstant and tolerant to tomato yc:llo\v leaf curl virus i:;sued li-orn L~vcc~pc.r:si~i~n hir.sulurn. Phytopatholc~gy 88:') 10-9 14.
Willi;2mson., V.M., Ho, .I.-Y., Piu, F.F., miller, N. and Kaloshian, I. 1994. A PCR-l-)ast:d marker 1.igl-~tly linked to the ~lt:matocle resistance gene, Mi, in tomato. Theor. Appl. Genet:. 87:757-.76:3.
Zomir, D., Elkstein-Michelson, I., Zakay, Y., Navot, N., 71:id;ln, M.:, Sa.rfatti, M.. Es.heci, Y ., Ilnrcl,, I:., Plcl,an, 'I'., 'V;\i~-Oss, I I . , Kedar, N., I<abinc~wilc;h, 1-4, and C ' ~ ~ : j n e k , ti. 1904. Mapping; and il-.trog~.ession ol'a tonlato yeillovri leaf curl v i~us tolerance gene T'y-1. Theor. Appl. Gener. 81?:141-146.
Zhanl;., L.P.., Kl~an, A,, P;ino-.l,i~.~, 1). and Foolati, h1l.k. 2002. A moleculnl~ linka!!c l:ii\p ol' tonlato displayin;< c~~ro~no: ;o~na l locations of resistance gene analogs based on &~'c.oper:;irolr >sc.~(lerl/!41n x L.~vc.~-),nersico~l hilsuhim cross. Genome 45: 133.1 46.
Figures
Fig. I . Multiplex CR for amplification with primers REXFl/REXR2 (720 bp) for the REX-I locus and with Lp-M~-)-]ocus-specific primers PM3FblPM3Rb (500 I;p) a[ 53°C annealing temperatule. Lanes 1 and 9, 100-bp marker (Tnvitrogen); lane 2. Moneymaker 4s11sceptib1e); lane 3, Sheriff (resistant); lane 4, Dom~nicluc (resistant); lalle 5 , Anahu (resistal~t); lal~e 6, TY52 (susceptible), lane 7, 111002 (susccptiblc); lane 8, water,
Fig. 2. PCR with primers P M i F j / p ~ i R 3 , which were designed to ampliiy an L. escuientum sequence from the cluster l e for the Le-Mi-/ locus at 53°C annealing temperature Lanes 1 and 9, 160-bp marker (Invitrogen); lane 2, Moneymaker (susceptible); lane 3, Sheriff (resistant); l a ~ e 4, Dominique (resistant), lane 5 , Anahu (resistant); lane 6, Ty52 (susceptible); lane 7, Ih902 (susceptible); lane 8, water.
Fig. 3. Multiplex P C1: for amplification ;v itln prirr~ers R EXFlIREXP.2 (720 b p) for 1 hc RE'X-I locus and with Lp-Mi-1-locus-specific pi-imers PM3FbIPM3Rb (500 bp) al 51°C annealing temperature. L ;anes 1 and 8 , 100-.bp marker (Invitrogen); lane 2, Moneyrr~ak~:r (susceptible); lane 3 . Anal-11 (r.:sistant); lane 4, lli902 (si~sceptiblc); lane 5, rnixtul-e o r Moneyniakel- and [11902; lane (5, I-nixlure 07 Anal-ILI and 111007; lane ;', \\~atcr-'l'hc ~nistiir~:s wcrc p:cp.~~.clA lo silni~ ialc hclcrozygoi~s plants.
Fig. 4. PCR with pl-ime::s PNliF3iPlMiJi3, which weire designed to ainplify an id. escul'elrl't~ni sequec ce from 1 he clcster 1 e for the ,Le- Mi- 1 1occ.s at 5.3 O C ' arinealir g temperature. :Larles 1 arid 8, 100-bp marker (Ir~vitrogen); lane 2, Moneyn-[aker (susc:epr:ibl~); lane 3, .4nahu (resistan:); lane 4, Ih902 (susceptible); 1,me 5 , mi:<tul-e of' N[oneyrnak.er and IhSl02, lane 6, mi;<tul-e of Anahu and 111902; lane 7 , water. The mixtures were pr1:pared to siniulate heterozygous plants.
Molecular Characterization of Tomato-Infecting Begomoviruses in Central America and Development of DNA-Based Detection Methods
M.K. Nakhla, A. Sorcnsen and D.1'. Maxwell I , . hlejia University of Wisconsin-Madison Llniversidad de San Carlos USA (iuatcmala
P. Raniirez and J.P. Karkashian Universidad de Costa Rica, San Jose Costa Rica
Keywords: Tollltrto severe let$ CLLI-1 virus, Totnuto ;.olden luottle virus, Tomuto l~liltl nzottle virus, Tonzato yellow nzottle virza, Pepper go'delz nz~saic virus, Tomato moscl;c Huval~u vznis, Tonzato leczf ctlrl Sii~alou virtu, Pepper I~ui~sreco yellow vein virus
Abstract Begomoviruses cause great losses of tomato crops in Central Amerii a. Eight
begornoviruses were identified by sequcncing PCR fragments. F o u r of ~ h e s e were new viruses: Tonlnto severe leaf curl virus (TdSLCV, AV130415), Tomato goldetr mottle virus (ToGMoV, AF132852), Torzato niild mottle virus (ToMiMoV. AF131071) and Tomato yellow mottle virus (ToYMoV, AF112981) and four were previousl! characterized: Pepprr golden mosaic virus (PepGMV, AF136404) Tomato mosuic Havnna virus (ToMHV, AFi39078), Toniato leaf curl Sinalou virus (ToLCSinV, AF131213) and Pepper huusteco yellow vein virus (PHYVV). A general probe, consisting of the most conserved region of the CP gene of Bean yellow golderr mosaic virus (BGYMV, M91604), was used in non-radioactive hybridization methods to detect these viruses. Specific probes, which consisted primarily of the common region for each virus, were developed. Specific primers for PCR identificat'on were designed for each virus, and the PCR fraglnents obtained from plant sarnples with these begornovirus-specific primer sets were sequenced to confirm the primers' specificity. ToSLC\', ToMHV ar,d ToMiMoV were present in tomato3s from Comayagua, Honduras. ToYMoV and 'I'oLCSinV were present only in samples from Costa Rica. ToSLC'V, ToGMoY, ToMiMoV, ToMHV, PepCMV, ToLCSlnV a ~ i d PHYVV were detected in tomatoes in one valley in Guatemala. ToSLCV o n l j existed in mixed i n f e c t i o , ~ ~ w ith a nother b ipartite begornovirus, a nd n o D NA-B vlas ever identitied for this virus. These detection ~ncthods were used to ownitor begonloviruscs in toolato-breeding lines being developed in Guatemala for resistance to these viruses.
6'
INTRODI!CTIOI\' Tomato-infecting bego~r,ovirnses cause serious losses throughout Cc~llral' Amcrica
(Morales and Anderson, 200 1 ; Jones, 2003). In many Iccations, incidence is 100'% during the dry season and losses may excred CO%. These epidemics are associated with the changing agricultural practices, such as continuous cropping of tomatoes and increased cultivation of hosts for the natural vector, Rrnzisin tnhaci (Polston and Anderson, 1997). Since resistant cultivars are not available, the major control measures have involved numerous applications of insecticides, e.g., applicatior,~ every third day. Losses have been so extensive in some areas of Guatemala and Nicaragua that toma~oes are no longer grown. The begonioviruses associated with tomatoes in Centrpl America have not been molecularly characterized. Thus, this study was undertaken to provide sequence data for the begonioviruses associated with tomatoes collected in Central Amecica, an4 these sequences were used to develop specific molecular tools for detection 'of th:se begomoviruses and to apply these tools in a tomato breeding program in Guatemala for begornovirus resistance (Mejia et al., 2005).
Proc I st IS on Tonidto D~=xascs 277 Eds M T Moniol, P SI and J I3 Jonc5 . .
<:ltlaractc:rii!ati~n of'l'ort~ato-1nf'ec:ting I3eg,olnoviruscs from Central clnlerica 'i'omatoes exhib l ~ n g bt:go.:noviral synlploms (leaf' curl, leaf cr~~.mple, yc:llow
mottl(: and dwarfing) here c~ollc:cted froln G~~aten.~a:a , I-londuras, Costa Rica, a,-~tl Ni~aragu~l . 'Tissue.; from young lea~des for analysis were used for DNA e.utraction. l'issues were s to~ed either. dried 'or ti-ozen Disc!; were cut from fr.esh leaf tissue wir-h a f1sml:- stt:rilized, num'ber 5 corlc bore-, placed i r l sterilized 1.5-ml mic:roSugt: tubes artd 5.tored at -80°C'. Dry samples were storecl as 0.5-mn1-.wide strips cut wii:h 21 flame-sterilized blade, dried at Iqoonl ten~perature, ])laced in paper en\lelopf:s, ancl stored at roonl tcmperc.ture. D'NA from ple.nt tissue was extr~cterl t y a modified Dellaportil method (Rojas et al., 15193: or by the Puregene DNA Isolation Kit, ('ell and Tissue Kit (Gentra S;ys!enls, Minneapolis, PvIN).
PCR products containing :he common region and part clf the Rep and C'? genes of az . =. - -
DNA-.A were libtained using degenerate geminiviral primer set (Pliepvl97S: .5' GCC'lC'A('ATY G1'C1'T17(_'C:UGT 3'1PC Pc7 15 5' 1'~TI>ArrR'rT'Y'T~C'RTCCATC'CPL 3 '; Potte-- et al., 2903) These fragri~er~ts were cloned in pCFU. 1 bector (Original 1'A C'lonirlgK K.it, Inl~itroger. Corpoi.ation, Carlsbad: CA) and sequencecl using Big Dye Sequc:ncing KitTrv' ~(Bi~siech~~ology Cente-:, Madisdn, WI). Sequence analysis was ac;co~nplished by comparison with known DNA sequences through thc: Natiol.lal Center for Biotechnolopy Infornlation BLAST program, the GCG program (W iscon5,i.l Pac,kaj;e Version 10.2, Genetics ( 'on~p~~ter (3roup. Madison, VJI) and by DNPLM.4N Vcy-sion 5.2.9 software. T,ynnoi~ BioScf., Canada
F.~ll--ler~g:h P(C'R lkagments were ob.;air~ed for ToGlvlo V and Tc'S LCL. -['he PC K overlapping primc:r set I, l'l'oGPlo\/A~,~f-NcoI: 5' 'I'A'I C'('<' 4T(-i GT'T (".1"(; <;Pi(; ( ' ("I ' T'TG CC, 3 'lP'To(3MoVP~cf-Ncol: 5 "TA T TC(' AT'(; C;G?i' TCC' TICC A'1'7' J'C(' A("]' C'TC c' 3 ' ) was ~ s e t l tc, amplify tlie f~~ll-length Cragmcllt 01'l'oCiMoV I)T.IA.-A, and the primc:~- st:( F'ToC;RIIo\lBvI'-Apal. 5' AAC A(3G GCC l~'A7' AA,4 PLAII CL'C G(.'(; C' 3' / F'7To(3NLoS'Bcf-P~paI 5' 'TTG 1 G(; C-ICC CGCr C;'TA GGT APLA AA.A 'TCG (: 3' was used to smpli-Fy ,the DN A-B. .4lso, the ob erl.apping, primcr :jet PToS.LC VA vf-Sacl: 5' AAA AGA GC'T C'1 C T'T APLA AC'T CT,4 T'G1' 'TGC TC;G 3' i' P7ToEmLC'VLicf.-Sacl: 5' AAA. AGA GCT CCC CIZT GGT GTC CT(3 CiC :3' ~lsetl to amplify DNA-4 clf ToS LC'V. A full-length clone of D-NA-A 0:' Pepper hurlsteco ;vellow vein virus (I'H'IVV, AY044162;l was provided by ILL. Gilbertson (Uni.iersity of Caiifc'rnia-Dav~s) ant1 was used 2,s positike control for virus detection f:xperiments. B e m golclet! vello i.v ~ ~ ~ o s ~ : l i c virru fiill-length DNA-A clone pCiAA1 (B(>Y'MV, M91604) (Gilbertson et a1 , 1991 ) . was I I S O ~
a!; p'xitive control targzt DNA for tF.e degenerate primer set PRepv1978/?CPc715. 7 o111t1:o , \wllo~) lt '~!j ' C I I V ~ ~~i~.rl.y irI"Y' I , lX) inr'e(:tio~~s clone?, p'I'YFG 1.4 1;A'(5!)4 1 74). cc as used as positive iontrol 1;lrgct 1 )NA Ibr this virus.
i.! PCR Prloto1col.s and Begornovirus-Specific Primer Design
P, specific PCR p;imer pair was d,evelol)ed for eachl 01' eight tomato-infkcting begonlo1iinrse:; (Table 1 :I using; uniqt~e conserved, regions of the viral gen.om,e identified by s~:~quence alignments fo:r the ,Yep gene an.d conlmon region (data nclt shown). The spec:.ficity and robustne:;~ of 1:he specif3c PCR :primer pairs were tested by PCR with s.tantlard vi:ial DhIAs frorl~ scquenc:ed clones.
E'CR parameter:, for the eighl. sets of specific primers were optimized lor 25-pI reaction:; contsining 2.5 111 of 2.5 mlvl cleo:ryl:.ucleotide triphosphates (dN'TPs), 2.5 111 of lox buffer, 2 .5 111 of .!O n1M MgC12, 0.2 pl of T ~ l q DNA polymerase, 2.3 pl of 7ilcl enzyrne diluent (1:daho 'r.:chnology), 2.0 pl of each comp1eme:ntal-y and viral sense primer at 10 ph1, 5.0 pl of IlN.4 extract, and H20 . Taq DNA polymerase, N[gC12, 10x buffer, and dNTF's were purchased from Promega (!dadison, WI) and used as indicated tly :.he nnanufac:turer. The target DNA5 from infected plants were diluted 10 times and the c:lorled viral DNAs were usecl at 2,O nglpl. PCR cycle parameters for specific frazn~ent amplification with the jl)ccilic ~r in lcrs were a.s fi3llt,ws: dl;naturiiticn at 96O( for 30 scc,
278
annealing ternpcl-~ture as in 'l'ablc 1 Ibr 30 sec, and ex ten sic,^ at 72OC for 35 sec for 30 cycles. The slopc was sct to 2.0. Annealing temperature was dependent on thc primer set (Table 1). All reactions were i n thin-walled 0.2-ml Labsource@ I'CR tubes. I'CR- an~pliflied fragments were separated by gel electropho~.esis using 1 .O% to 1.5% Genepure LE agarose (IscBioExpress, Kaysville, UT). PCR reactions were performed in a Rap idCy~le r l '~ (Idaho Technology, ldaho Falls, ID). 7'0 confirm tlie specificity of tlie PCR-based diagnost~c tools, the PCR fragments f r ~ h i reactions with the specific primer pairs werc directly sequenced using Big Dye Sequencing KitTM. Sequences of P('K fragments from reactions with specific primer pairs that had a 91 % or greater nucleotide identity for 400 lit of the Re,7 gene and tlie ~ O I I ~ I ~ I G I I region to a known sequence were considered to be tlie same begonlovirus (Fauquet et ill., 2003).
Each sample was anlplitied with degenerative pri~iier pair set fo; DNA-A (PRepv 19781PCPc7 15) with the same PC'R conditions used for the specific I'ci< p~.imc~- pairs except that the I'CR cyclc parameters lor [i-agmcnt aniplification were as Sol:,)ws: _ ? _ ._ . . -. -
denaturation at 54°C for 1 min, annealing at 55°C I'OI 2 niin, and extension at 72°C l i ,~- 2 mi11 lbr 30 cycles. l ' l~ese cycles were followed by a final cycle of 94°C for 1 min, 6 l "C for 2 min, and 72°C for 7 inin, and then held at 18OC. Samples that tested positive with the PRepvl9?8iPCPc715 primer pair wsre then tested with the begomovirus-specific PCR primer pairs. The l atter PCR c ycle parameters were 11 sed also w ith tlie TYLCV- specific PCR primer pair (PTYIRv21: 5' TTG AAA TGA ATC GGT GTC CC 3'1PTYIRc287: 5' TTG CAA GAC AAA AAA CTT GGG ACC 3') to monitor tlie existence of this virus in Central America. These PCR reactions were perfonned in a MJ DNA Engine PT208 T h e r n ~ o c y c l e r ~ ~ (MJ Research Inc., Waltham, MA).
Nucleic Acid Hybridization Probes and Hybridization Protocols IVucleic acid hybridization techniques were developed with non-radioactive probes
for dot blot detection of the eight tomato-infecting begomoviruses. The specific probes for hybridization were designcd using the common region of the viral genomes. This region differs among begomovirus species but is highly conserved within a given species. A gcneral probe for hybridization with begomoviruses was based on the highly conserved region of the CP gene for Western Hemisphere begomoviruses. PCR primer pairs PBGGTv647 (5' TAT GTG TAT ATC CGA TGT CAC HCG TGG 3') and PBGGTc1048 (5' CGA ATT TTC AAT G'TC GCA TAT ACA GGG 3') were developed to produce the DNA for the generdl probe from DNA-A of clone pGAAl of BGYMV (Table 2). Virus-specif c DNA for probe labeling was produced by PCR with primer pairs listed (Table 2) and with cloned viral DNAs as targets. PCR conditions for DNA probe amplification were the same as for the degenerate PCR primer pair.
The Alk P h ~ s Direct Hybridization KitTM (Amersham Pharmacia, Pisscatway, NJ) was used for the non-radioactive labeling of p r o k s according to the manufacturer's
sl; instructions. Hybridization techniques for the speci$c probes used high string.ency with positively-charged nylon membranes (Biodyne A, Pall-Gelman, Ann Arbor, M1) at 65°C' according to the manufacturer's instructions. Law stringency was used with the CP- general probe at 55°C according to msnufacturer's instructions. The specificity of the liybridizatio~l tcchniclue was conlirnied by using hll-length cloned viral DNA of DNA-A from rcprescnta~ivc ol' (IiSl'c~-cn( pliylogcnclic clustcrs (I7aria ct al., 1004) 01. begomoviruses: 'Ietrtr tlwtr~j'~~lo.stric virus (pHLlA 1 ), &cull goldetr nzostlic virtls (pBZA I ), and Betril goldo~r )-ellow, nrosuic: vil-lls (PGAA1) M 2re obtained as infectious clones (Gilbertson et al., 1991 ). Reurz calico mosaic virus was a full-length clone (pBCaMV-A2) and TYLCV was an infectious clone (pl YEG14). These viral DNA targets were obtained by preparation of the plasmids of the full-length cloiles and spotting 25 ng DNA on tlie membrane.
Also, viral DNA from PCR fragments prepared from the clones o? the eight tomato-infectini begomcviruses ..vith the primer pair PRepv 1978iPCPc: 15 sei-ved as positive control DNAs fo r evaluation of the h ybridization methods. Twenty-five 11 g o f DNA of each o f t he e ight targeted v iruses were spotted o n each m embrane a s control
279
targeis. DNA from plant tissue was extractcld using the Dellaporta n~ethod and 5 p1 oS thc DNA extra.ct was spolted on the mewbrant: as the target for hybridization. 'The results ol' the hyk)riClization and PCR ex;perimc:nts were compared with those O F the dilect seq~.::ncing of the PCR-iimplified fiagrnel-~ts to confirm the specificities 01' both techniques.
1Jtili;cing the Diagnostic Tools in a Tomato Breeding Program for Resi!;tance to 13ego1novirur;es in [Gua tenlala
Young tomato leates were collected in March 2004 ii-orr~ different lorrato 11rec:ding li~ne:; arid corr~rnzrcia'~ liries expressing various disease severity indexes (DSl, see IMejia et al., Z1005). DNA was extracted frclnl plant tissue by Puregene DNA Isolation Kit Cell and 'Tissue Kit ((3entra Systems, Minneapolis, MN) and exa~nined with '70th PCR ,and !lyOricliza tion tt:chni ques.
Mol~eciilar Characteriication of Tomato-Lnfiecting Gerniniviruses in Central .4rr1erica PC'R products containing the common region and par1; of'the R1?'~ and CP gl=nes of
D l - wt:re obtairied ( ~ 1 . 4 kb) using degene.rate peminiviral prim~:r set PRepv 1 9:78/1'CI'c7 15. These fragn~en ts were cloned dnd seq~encetl ('l'aklle 3). Seven dif.krent i.on:,atc~-i~~fecting be~go~~ioviruses were iidentified in tcrnatoes growing in Central America. Four of tnese iverlz new viruses: Torrzato severe leaf curl v iru ,~ ('ToSLCV), Tomuto goltierl r;jcdtlc vi,.u.s (T'oGMoV), i'bmutcj nziltl nzottlr virus (TolMi~vlo'V) and To~ji(ztc, yellow r?~ottltr virus (ToYlvZo'V); and three had been previously characterized: Pep,ver- goitierr /~losar'c virus (PepGMV) Tclmato nzosaic EJu/unc~ viru:; ('TobllHV) and To,?rut(:, iI?uJ curl ,!iinczloa virus (ToLCSinV). Based on the ob1:ained sequences, specific primers were des iped and i~sed to arnplify full-length clones of DI'JA-A for Tc~Gbllo\J and ToSLC\I (Table 3 ) . Speciiic p ~ i n ~ e r s were alsc used to amplify a fi~ll-length c:lone of the DNA-B of I'oGh4oV No T1N.A-R was ever idcntif~ed for- this Sor ToSLCV and i 1 always exited in r..iix~=tl infec:tions with another bipartite begor11o~iru.s (data not :;hewn). DNA-A of 'r 0SLc.V was also 'isolated i-n 1997 from cucumber p: rowing 1iea.r S,marate, Guatemala (AFI 3 : 735).
T'he primer set PPHY-V\Iv/PPI~IYVVc specific fclr PH\I'V1\I v ~ a s used 1.0 examine to~n.ato siimples cc)lle~:l:ed from (3i1ilteinala. Sequerlce analysis of the PCR-a.mplified 700- bp 'DNA fragii~ent showed 9.7% nucieotide identity to PH.Y\IV. This 3rovecl the 3.risienc:e of F'HYVV in (3ur:terlala.
Sequences ot' the eight cliffkrent tomato-infecting gerr~iniviri.~ses cletected in Cel~tral America in this study were anal:yzed Logether w8ith twelve pretiously itientitied, w11.1tel'ly-.transmitted gemini-,/iruses. The relations{$ps anlol-lg the 20 whitefly-trensmitted geminiviruses were based on 805 nucleotides of the hi-terminus of the Rep gene. Se:cluence anallysis shclwed that the eight identilfie'd viru:;es are: from different species. A phylogenetic tree (DhlAMAN :;oi'l.ware) indicated (Fig. 1 ) tha.t T'oYMoV anti ToGMoV ar'2 not T elated and 1:hey a re: not closiely related 110 any of the i dentified g e r r ~ i ~ i ~ ~ i r u s t : ~ . To:LCSinV i s i. n t ' ~ e same c luster as Potato yellow mosui8c Trinidud virus ( Pk'MTriV), To'MiMoV grouped with Ibn;!ato r;agclse mosaic virus ~(ToRhlv:~. ToS LCYV is most closely relaied to Syuczsh l e ~ f c u r l virus (SL,C\/). Using the Phvlogenetic tree (Fig. I ) we cam put the: eight: detected begon~oviru:;es in Ce:ntral America in six different. groups. Group one ha:s T oYhlo\l. Group two has P YM'l'riTJ, 'ToI,CSin'J, a nd. TohlHV. Ci roup three h as P HJ'V'J. ~ G ~ O L I P O OUT hias 'ToItMV, Potato . ~ i ? l l o ~ ] m o.raic:. v i'rus ( E'YI'JIV) a nd ToMiMoV. GI-oup five has 'ToGMoV. G:roup six has ToS1,CV: SZ,C\I and PepGh4V.
Ekaluation of PCR. ,?rimer Pairs Desig~led for I)?tection of Begornoviruses Using Cloned DNAsi as the 'Target DIVAS
'The begon1oviru:;-specific PCR pr1mc.r pairs c,eveloped for each of the scbcn isolaled viruses produced the expected fragments 01' ca. 400 bp. Thc: specific primzrs
designed for PIHYVV amplified the expected 700-hp fragment. All primer palr.; an~plify only their respcctive viral DNAs. The specificity of the primer pair for eac'7 virus has obtained by adjusting the annealing temperature for each set 01 primers (Table 1).
Evaluation of Hjbridization Probes Designed for Detection of Begomoviral DNAs with Cloned DNAs and Plant Extracts
The PCP. primer pairs (Table 2) designed to amplify specific DNA probes from cloned viral DNAs gave the expected sizes, which ranged from 120 to 700 bp. All probes were specific to ;heir respective viral targets and did not give hybridization signals with symptoniless tomatoes or from the other twelve different cloned viral DNAs (seven characterized tomato viruses froni this sti~dy plus the five standard viruses from different phylogenetic clusters). Tile general probe gavc strong signals with all five different cloned, fiill-iength viral DNAs fron~ different clusters of begomoviri~ses '(BDMV, BGMV, BGYMI', BCaMV and 'I'YLCV) and did not react with the healthy tanlato extract .
Field Survey of Tomato Plants C~llected in Central America The general and specific detection tools developed were applied to field-collected
tomato tissues from 1992-2004 in Guatemala, Honduras, Costa Rica, and Nicaragua (Table 4). All 88 tomato plants tested exhibited leaf curl, mottle, andlor go ld~n mottle symptoms. DNA was extracted by the Dcllaporta method (Rojas et al., 1993) ~ n d tested with FCR and hyjridizatio~i methods. Seventy-three samples gave hybridization signals with the CP-general probe. The degcnerate DNA-A primer pair (PRepv 1978/I)CPc7 1 5 ) detected btgomoviruses in 82 samples. PCR primer pairs and hybridization probes for thc specific v i ~ ~ i s e s de~ected the presence of tomato-infecting begomoviruses in 82 ol'the X X tomato saniples collected from Central America (Table 4). The PHYVV-specific probe and PHYVV-specific primers were used only on samples collected from Guatemala in 2004, and were i ~ s e f ~ ~ l in docunienti~~g the existence of this virus in Guatenials. Six of the 88 tomato samples did not give PCR fragments with any of the primer pairs or hybridization signals with any of thc probes. Thcir symptonis may have been due to viruses other than begon:3viri1ses or environmental factors. Our resirlts are ,:onsislent with the many reports (Potter et al., 2003) that have shown that PCR methods are more sensitive than hybridization methods for detection of viruses. ToSLCV, I'oGMoV, ToMHV, PepGMV, T oLCSinV, ToMiMoV and P HYVV welz d etected i n tomatoes i n one valley near Sanarate in Guatemala. ToSLCV, ToMHV and ToMiMoV werc: present in tomatoes from Comayagua, Honduras. Only ToYMoV and ToLCSinV were n r~sen t in samples from Alajuela, Costa Rica. Only ToMiMoV and ToLCSinV were presen. in Nicaragua in sa~.iples collected from Sebaco Valley in 1992. TYLCV was never identified in any of the tomato samples examiiied in this study.
(r
Confinnation of Specificitj of the PCR and Hybridization Diagnostic Tools Positive and negative controls were included in each experiment to corfirnl the
specificity of the developed diagiiostic tools. In each experiment, the positive and negative controls reacted as expected. One hundred eleven PCR-amplified fragments from thirty-nine tomato samples were directly sequenced to confirm the specificity of the designed PCR-primer pairs. One hundred six PCR-amplified fragments were obtained froni tomato samples collected in Guatemala in 2002, 2003 and 2004, and five PCR- amplified Cragme~ts with primers PToYMoVC 1 viPToYMoVC 1 c were from tomato samples collected in Costa Rica in 1994 and 1996 (Table 4). All fragments obtained with virus-specific PCR primers had a 91% or greater nucleotide identity with their respective viruses for 400 nt or more for the Rep gene and the common region. Twenty-nine PCR fragments obtained with the ToSLCV-specific primer pair were identified as ToSLCV, twenty-eight as ToGMoV, thirteen as ToMiMoV, another thirteen as ToMHV, eight as ToLCSinV, seven as P epGMV and eight more as P1;YVV. These PCR results a greed with the hybridization results.
Tile PCR ;tnd hj1:1-idizalio1-~ diagnoslic ;:ools d.eveloped were usc:ful in n:onitoring tonlalo-i~lfeztir~g begornoviruses in Central /,merich. 'Thesc diagnostic tools are fast, sensilive. ar~d acc1.1ra-te and can be used to detect thcse v-i~-u~,es in maliy :;an-~ples. 'With the non-radic)active hybridization melhoti, the begornoviruses can be identified dnd their conct,ntratic~n in the plan!s estirilated. These detection nietl~ods will have applications in e~idemiological rtudies ancl will be useful fbr monitoring bef:omovi~-u.;es In tomalo gennl)lasm in tlrerdii+~g programs for r~:sistance.
Appljcaticin! olf P 213. llybridiza~tiot~ 1) ctection Rlctl~ods i n a T onlato , l l rcct l i~~g I'r.og~-;~m in Guatemala
Tile PC'R detection ancl hy1)ridi;cation prvto~;~)ls developed were ut::iizr:d in :I
progr;lln for breeding tomatoes resis:ant lo begon~ovir\~scs in Guatemala (sce Alcj~a cl a!.. 2005). 'The bel;o~novirus re:;ist;lnr lin.es, (;1:113 aud Gcl6, had beg~movirus resistance genes From int.rogres;ionr; from Lyco,~ersicon Izirsut~.lni (Vidavsky and C::osi~k, 1988) and L,ycoj>rrsicor.z ch~;lm.~n (:Scc'tt i:t al., 1995): respectively. ?(ou.ng t i s s~~es (thirty daj.s after transplanting,) cver'z collectecl fson~ begon~ovirus susceptible line (lu182) anel F 1 populit~:ions (susceptil~le x resis~ani; resistant x resistwt), and DNA was extracted using tht: Gc.ntra Extraction kit. Hylxidizeltion with C1'-general probe (Fig. 2) and with the t:igl-~t begon~oviru~;-specific pr11l3es gave po!;itive signals ti)r seven begomov~rus.es (Table: 5:). Only 'T'oYMoV not dett:cted in t h e s ~ samples; this result,; a ; p : M ith thl? previous survey data, since this virus has no1 been detezt'td in (;uaternala (Table 4). Eac:h line :ind F1 gerl-np,asin was infecled with at least two different l>el;omoviruses except the r~:sis;tant F1 gernlplasm, .XAl?:> (Gi13 x Gc 16). which did not nave a positive hybridizatiori signal with any of the pro1,les. FIybricl 32.175 had oo viri~l syn-~ptoms. However, when thc degenerate F'CF. priniers were 1.1sed with sanlples froin X.41'75, PCR fragments were detectt:d, ancl both ToGhll~V-. arld 'I'ondiMo\J-si~ecific primer s,ets gave PCR 1'1-ag;ments. Since 110 hybridiza1:ion si;:nals were de1:ected f rom these plants, the viral rite): is very low; ancl this might explain the lack of syn~pl:orr~:. !< trclng h ;/bridization :; ignal:; were noted with each of the other two hybrid. lines, which had one resistant parental line crosst:d cvitkr M82 (T'able 5). The hybrid line XA176 (G16c x M132) has resistarce genes from tht: Lycopt~~~sicon cr'lilerlst~; arid it had a modeiatc symptoms (DSI = 2.5) ancl positive: hybridin:ation signals with the C:P-general probe and with five diffc:rer~t begornovirus- specific probes (Table 5). The hybridizntion signal was strong with the CP-g'zneral prc~bc., the To:SLC'V-specific probl: and \:he ToMHV-specific probe (Fig. 2 ) but 1:he signals were weak vi.it.h tht: ToGMoV-, 'Tol\dihllo\J- and PHYVV-specij'ic probes. Also, anotl-~er hybrid line Xi4 188 ('G 1 311 x R48;!), which has I-esista-ncz genes, from Lyrzopersicon hirsi,lttlin, ;lad very slighi. symptoms (DSI =. 1) a.nd had positive h:ybridir:atilon signals with the ('P- general prohe and livc difli.1-ent I~cgomovirus-specilic probes (l'able 5 ) . 'The CP-general probe and the begon10vi1-us-specilic pirobes for ToSkiCl' a.nd PepGMV gave medium
wzs .. hybridization signals with this hybr:id, whereas the hybridization s,igrals of the specific probes for ToGlvloV, TolcliNloV alld Pl3YVV were we,xk. PCli-amplified viral DNA fiagnie~~ls of'lhe expected sizes bere detected in all plants that had pos'iti\lc hybridization signals (Fig. 3). In a fc:\;v. cases, viral DNA fragments of the expected size wlxe succ~essfi.il1-y T'CFt-amplifiecl from samples with no positive hybridization signals (?'a'bIe 5). 'The .susceptil-)le line h1232 .was infected with at least six bcgomoviruses in one plant (To!;IX"rl, 'I'oGhloV, 'ToMiMoV, 'I'oMI-IV, I'oLCSinV, and PHYVV). In another M82 plant, five begomo!.iru>;es ('ToSLC'V, 'ToGhlo\l, ToblH'~', ToL,CSin\J, e.nd PHY\!V) were detectetl. In ,a third plant, ol~ly two begornoviruses (1ToSLC'V an~J 'ToE4YV) were identifie:(]. Commerc:ial hybrids, Elios, h4arina, Silverado, i~nd Tango, were infectecl with ToSLC'V' and ToGhloV. The specih: d:~agnostic too'ls detscted ToS;LCV in all lines and hybrids (except the highly resistant hybr~d XA175, ToGMo'f in 2\11 line:s 2nd hybrids, Pep(3MV only in the resis1:ant line X191 88 and El.ios, 'foMiMoV in the line M.82 and four hybrids iXA175, X,41:76, XAI88, and Silverado), but not in 'Tango, Elios and Marina. 'Tob[H\' was delected in h18;! and all hybrids exczpt the resistant hybrid XA.17.5 and Silveraclo. To1,CS;n'V was found onl!,l in the suscepti.bIe line P1/18;!. F'HYV'f was detected
282
in ME2 and XA 176, Elios. and Silvel-ado (Table 5) . For all the samples that gal, e positive hybridization signals with the CP-general probe andior fragments with the degenerate PCR primers set (PRepv1378lPCPc7 15), there was at least one begomovirus detected with a virus-specific diagnostic tool.
These data indicate that toniaro ;iybrids being devclopcd Tor G~~atcnia la must havc resistance to m~~l t ip lc bcgonioviruses. Also, since it is expected that .I'YLCV will eventually be f o ~ ~ n d i t Central America, all begonioviri~s-resistant tomato hybrids for this region should have resistance to both bipartite and monopartite begomoviruses.
ACKNOWLEDGEMENTS This research was s~~ppor led partially by a grant from Bean-Cowpea
CRSPlUSAID grant, a CDRIUSAID grant no. TA-MOU-0 1 -C21-008, Universidad de San Carlos de Guatemala, and the College of Agricu1;ural and Life Sciences, University of Wisconsin-Madisc~i. The authors thank Lane Milde for assistance in designing and testing the specific primers for PHYVV.
Literature Cited Faria, J.C., Gilbertson, R.L., Hanson, S.F., Morales, F.J., Ahlquist, P., Loniello, A.O. and
Maxwell, D.P. 1994. Bean golden mosaic geminivirus type 11 isolates from the Dominicar7 Republic and Guatemala: Nwleotide sequence, infectious pseudorecombinants, and phylogenetic relationships Phytopathology 84:32 1-329.
Fauquet, C.M., Bisaro, D.M., Briddon, R.W., Brown, J.K., Harrison, B.D., Rybicki, E.P., Stenger, D.C. 2nd Stanley, .l. 2003. Revision of taxonomic criteria for species demarcation in tFe family Crnzi~.livil-ici~le, and an updated list of begomovir~~s species. Arch. Virol. 143:405-421.
Gilbertson, R.L., Faria, J.C., Hanson, S.F., Morales, F.J., Ahlquist, P., Maxwell, D.P. and Russell, D.K. 199 1 . Cloning of the complete DNA genomes o f four bean-infecting geminiviruses and determining their infectivity by electric discharge particle acceleration. Pliytopathology 8 1 :980-985.
Jones, D.R. 2003. Plant viruses transmitted by whitellies. Europ. J. Plant Path. 109:195- 219.
Mejia, L., Teni, R.E., Vidavski, F., Czosnek, H., Lapido:, M., Nakhla, M.K. and Maxwell, D.P. 2005. Evaluation of tomato germplasm and selection of breeding lines for resistance to bcgonioviruses in Guatemala. Acta Hort. 695:25 1-256.
Morales, F.J. ar?d Anderson, P.K. 2001. The emerger.ce and disseniination of whitefly- traiisnlitted geniiniviruses in Latin America. Arch. Virol. 146:4 15-441.
Polston, J.E. and Anderson, P.K. 1997. The emergence of whitefly-transmitted geminiviruses ill tomato in the Western Hemisphere. Plant Dis. 8 1 : 1358- 1369.
Potter, J.L., Nak'lla, M.K., Mejia, L. and Maxwell, D.P. 2003. PCR a1.d DNA hybridization methods for specific detection of bdn-infecting begomovin~ses in the Americas and Caribbean. Plant Llis. 87: 1205-1 2 12.
Rojas, M.R., Gilbertson, R.L., Russell, D.R. and Maxwell, D.P. 1993. Use of degenerate priiners in the ;,olynierase chain reaction to detect whitefly-transmitted ger~iiniviruses. Plant Dis. 77:340-347.
Scott, J.W., Stevens, M.R.. Barten, J.H.M., Thome, C.R., Polston, J.E., Schuster; D.J. and Serra, <'.A. 1995. Introgression of resistance to whitefly-transmitted gemi~~iviruses from Lycoper.>;con cllilel~sr to tomato. p.357-367. In: D. Cierling and K.T. Mayer (eds.), Betnisirr 1995: Taxbnoniy, Biology, Damage Control and Management, Intercept Ltd., Andover, UK.
Vidavsky, F, and Czosnek, H. 1998. Tomato breedirlg lines immune and tclerant to tomato yellow leaf curl virus (TYLCV) issued fro111 L)~~oper.~ico~i I~irszltill~~. Phytopatholugy 88:9 10-9 14.
Tables
Table 1 Elegomovirus-k,pe(;ifi~; PC$: rimer:; for det~zction of eight tomato-~nfc:cti?g b ~ g ~ ~ m o v i r ~ ~ s e s t l~at were identified in Cenh-a1 America.
tar):^: t Annealing f'rinler naine Primer secluence virus 1 emp. -- -
5' CGTCOT('TTTG'TTTGATTr-TCIT 3 ' s LC v 15q°C PTo5;LC7dG I v PToSLCVG I c 5 ' GGGACACCAG(;ACACCAGC 3' * L . - -
PTo(;M(,VCi2v PTo(JM~VCI~C PToFAI~VIOVH I \ PToh l~b~(>VH lc PToMI I'JH;'v PTot\AH1J1i2c l'1.0)'M CIVL I \ PToYMoVC l c 1'1 ol.( Sll~vIC2v 1) I [)I ( % S I>\'L?C PPcpGML G3\ PPcpGM\'G3c I' P 1-1 'I' v \I\ PPH\I'V\;c
- ---
5' TGAAGT(;C7'TCTTOCALCTCC.4A(3 3, 5 ' CTCTCCP.AGCGCTATCTGAGG 3 ' 5 ' CATTTAL~GGCCTCTGC:GGCAGC 3' 5 ' GAGATTCA1'\AGTTTC1,-ATAGGACC 3' 5 ' CC'~TT<~CAT~TGTP,TCGT'~'G(;CC:C,IZ 3' 5 ' GGAAC AAGATTAATAGT*TTCTATrl(;A(;G(i 3 ' 5 ' ' I 'CI'C;'I'ACT(;CAi~A'I'l 'C'AG I'AOAI:(;(' 3 ' 5 ' GGAACC(:AI'iTTGGl'(i7"l'A<:GC'I'(: 3 ' 5 ' GA AA'l'(i'1'TG'l'G C;'r'l'(;'l'.r'(.T'l.(.<'('(i 3 ' 5 ' GI'C'C'( 'AI' ,AAC''I 'C'C'IZ'I 'P~C;/\ .C~AC~ 3 ' 5' CGTC(;TCTT'TAI'TGGCCT7-C?CiA I! ' 5' C:AGA,4(;l"1'GAGAACT(~l1C~(~-rGG 3' 5 bGCa4G(~L~<~CA.'l~CAC.4'~!\C'I',rl"l'A'l'CP (jAC' 3' 5 ' SCCCI'C4CGTGTACGP.AC ATCC'1'AG 3' . - ------- --- .
1 able 2. Primers clevc1opt:d for PCR-amplification of a viral DNA fragmeslt to be laheled ar tL used as a Irregon~c~.iirus-specific probe for DNfi h:y.bridization.
-- Target virus Pirimer -- name: Pr.inle:r sequence ? 'OS~~C\/ PToSLC\.'/lcrv 'I' 'TGTAP.ATATGAGC\:A(;GPPCACCAG~S 3"
Pl'oSLC\'/icrc 5 ' ;4A~I'1'1GCCCTT(;GJ,GTCCCCPrACiAGG 3 ' TOG h40.V PToCMoVv 'I' I~TAATTAAAGGGTGTC;TCCA,~T~~GP ' SC 3 '
PToGMoVc 5 ' (3TCTCCAAGCGCTt\TCTG4G(? 3' ToMiMoV PToM iMo\fv 5 ' (3T/\GCiATACCC.4A7TTCiAGCT TTCTTCG 3 '
PToM iMo\ ic 5 ' C:G<;ATGAGATTGAAA(3TTCT4TAGGA('\' ? ' ToM1IV P7'oMHVv 5' (3TAAT'TTGG,4GCTCiTACACCAAI'TC AGC: 3 ' .
PToM HVc 5 ' ( 3C< :AC:GTG'T4GGAACk\A~ iATTAAT~4GTTCTA 'AA 3' TOY Jlo'v' PToY Mo'd i, 5 ' (3TPiAT'PAAGAGCGT.'\t\CPLCCAATT(3G(J 3'
PToY Mo'dl: 5 ' GGi\GPiGT7TCT A(J'TATTGAGA13 3" ToL(JSiIIV P'l'oLC:Si~l\:v 5' ~'TTGGTA,~TAATAAGGGTGT~ST/~CP~CCG 3 '
P7'oL(3Si11\fc 5 ' /\CC;TGTCCCI\AI\A<:TCCA'TA(~A(~A(~ 3 ' Pep(; lfllr P F'epCiM \J' \ $ 5 ' 1'AP.GC-PGTAGG,\C:TCCAGGAGACT'C: Ii'
I' P cpCi M \Ic 5' 'I'TI'GCIZC:'TC~GAG~~CC(~C~P\AC;AC;GC 3' PHY\/V PP ~ I Y V V V s ~(;CP,GC'GGC.Z~I'C,~C~\'I~.A.CA'I'T,~T<;AC.AC J '
PPHYVV.: 5 ' (;<:<.:CTCAI::C;~TC,I~AC.GI\ - AGCJi\TC;C;'l'ACJ 3 '
284
Table 3. Clor~es ,for the DNA-A inserts and their sequence accession numbers for the seven tomato- infecting begomoviruses characterized in Central America.
-- --
Virus Collection location Isolate Clone and insert size Accession and date nun1 ber
ToSLCV Silnarate, GT-I pTMSA-1 (2,593 bp) AF130415 Guatemala, 1996
ToGMoV Laguna de Retana, GT-R2 pTGTA2 (2,6 13 bp) ilF132852 Guatemala, 1944
PepG MV Sanarate, GT-S8 pTGT8A (1,352 bp) AF 1 36404 - -
Guatemala, 1996 ToMiMoV Comayagua Valley, HN-H5kw pl-INH5akw (1,345 b ; ~ ) AF13 107 I
Honduras, 1996 ToMHV Comayagua Valley, HN-H5 ?Hl\JBI45a2 (1,357 bp) AF13907X
HonCuras, 1996 l 'oY MoV Alajuela, CR- 1 PCK I A ( 1,647 bp) AFI 12981
Costa Kica. 1904 ToLCSinV AlZj~~ela, CR-2 $C4A (1,343 bp) AF131213
- -- Costa Rica, 1996
Table 4 PCR and hybridization detection of tomato-infecting begomoviruses using the developed diagnostic tools.
Location Begon iov i r~~ses detected b y either P C R or hybr id izat ion
and date ~ i n ~ s ' -- TOSLCV ToCMoV ToMiMoV ToMHV ToYMoV ToLCSinV PepCMV PI-IYVV ~. - -
C u a t e ~ n a l ~ 1090 2000 200 1 2002 2003 2004
Honduras I998 I999 I 990
Costa Kicd 1904 I 0 0 0
Nicaragua I902
-- - I S ~ ~ ~ n ~ n a r y o I 'd ata I-or I'CK wit11 d cgcncratc p riniers ( PRcpv 1078iPCl)c7 15) a n d I1 y b r i d i ~ a t i o ~ i w i t h C. P-
general probe. I \ '~ ln,ber o f posit ive san~plesl total samples tested. - N T = no tcst.
Tat le 5 . Begorno\~ir~ls~:s detectlzd in samples f r c~n~ the tomato breeding progran- i l l
Ciuete~nala using Plf R 2nd hybridization protocols. ~ -
Ce-11,- DSI' ToSLC Tc,Gblo PcpGhA Torgliblo T o b l H T o Y M o ToLCSir l PH"V Gelie-a14
.- -- - - - - --, ME2 2.8 t, + . . -I+ +IT -, - +It +/-t i i i i
X.4175 0 -1. -!+ .i. -I+ -I- - e - - I - -/- -!+ I
X.4 176 2.5 +/+ t!+ -1- i,'+ +i+ -, . -1 .. +!-t T ; i X A l S S 1 + '+ t i+ i /+ i /+ +I+ -i .. -1 - - I - iii Taligo 2 .0 + I+ -11 ./- .., - +I-+ .) .. -1 -I - 7 / A
I ! 1 -/A i : l~ - 1 - I I+ EI~II:; 3 -, .. -1 .. +I.t I ! I , j.( -I+ ..!- I : I Mal-~na 2 0 ., - -1. -1. -1- I li I
Srlw!~.a 2.8 t-,'+ + ~ I - + i t ~ - I - -1. -1.. t / - ~ I! , ' MP1. X A 175 1:(;!~13 .i (is. IO), XA 170 (LiclO x FA82j. ) i ; ~ 188 (GI113 ,; M82); and cc~n,n-~crclal hyblids. 'l'ii~~y,~. El~os. M;,~. ina. and S i l ~ c l - i ~ d o . PAS2 is sut;ccpl~bl~: to ~ I : ~ ~ I I ~ O V ~ I . L I S C S : GcIO , ~ n d G l ~ l i arc bcgo~nu \ irrls-rcsisi an1 hrc,:tling Iinc:s (Mcj i a ct i,;., 2'104).
2 .- rhirty-cay:-aftcr t~ .ansp la~~t ng; [ IS ] , 0 -- ~ l o syr,iplorns, I : 1:1osslblc s y n i l ~ t ~ ~ m s , 2 ' slight syniptonis, 3 strcng symlJtorns, 4 = sevr:rl? symptom:;
! Positive hyb~. idizat io. l sigl-alPC'R f rag l -nc~~t ' CP-Ciensral prc~be/Dcgene~.ate PI-iniel. SI:I (F'Rel,v1!)7S1PCPc7 15)
Figures
Fig. 1. Cladogram showing the relationships among 20 begomoviruses, based on 805 nucleotides of the N-terminus of the Rep g&e. Sequences were ~nalyzed by the Observed Divergency Cistance Method of the Phylogenetic Analysis Homology Tree module of DNAMAN software. Vertical distances are arbitl:iry, and horizontal distances are in proportion to the num!>er of nucleotide differerices between blanch nodes. The O/o nucleotide differtnces are presented by the scale at the top of the figure. The eight identified begollloviruses in Central 9mer1ca: PepGMV, PHYVV, ToLCSin V, T oMHV, T oMiMoV, T oGMoV, ToSLCV, and ToYMoV, were con~pared with other known begomoviruses: Chrno clel tornate virus (CdTV, NC 003830), Pepper goldell 11losaic virtu (PepGMV, NC-00410l), Peppe, ll~lnstecfiirtls (PIIYVV, NC-0013j9), Potato yellow nzosaic Pclrzurna virtls (PYMPanV, Y 15034), Potato yellow ilzosaic Trinidaci virus (PYMTriV, AF03903 I ) , Potato yellow ~~zosa;c vlrtlA (PYMV, NC-001934), Sqtiash leaf ctlt-1 vlrtls (SLCV, M38183), Tobacc~, Ieaf curl Japarl virus (TbLCJV, AB079689), Toi~lato lriosnic H~zvalitr \*r~-lcs (ToMHV, N C 003867), Tor~znto ruottlt-' T~ziilo V ~ I . L I S
(ToMoTV, AF0 12300), Tonzuto rlzottle vir%s (ToMoV, NC 00 1938), Ton~uto rugose nrosuic virus (I'oRMV, 1UC 002555), 'She acronyms of the eight viruses detcctcd in tliis stuciy wcrc labeled :lithe cnd with C A [or ('entral America.
XAI 88
C1
C2
'Fig. '2 . Hybridization of'tomato samples and -~.irzll DTl/\ controls with the CI'-gi:ne::al ancl the TOM HV-spc~itic probe. (~olunins: 1-0 hybridized with tht: CP-general probe a). lovli strin.g~ncy condition.;; 7-12 hybridized with the ToMHV-specific probt: ai. high stringe:ncq condition:;. R . o ~ s : lvI82; XA1 75; XA176; X'4188: C l (1-2 and 7-8 = 'Targo; 3-4 and 3-10 == Elios; 5-6 and 11-12 -= b4arina); (3 (1 -2 aiid 7-8 =-
Silverado; 3-4 and 9-1 0 = Healt1,iy 'ton-~st~); 5 ancrl 1 1 = ToYMoV DNA; c: and j 2 =I
ToLCSin'V DNA); (3 (1 and 7 == T'oS1,CV DNA; 2 and 8 = 'ToGMoV DIVA; 3 ancl 9 == PepGMV DNA.; 4 and 10 .= 'I'ob/[iWoV D N A ; 5 and 1 1 == ToMI-I\' C'NA; (.I anti 12 = TYLTV E1N14); C'4 ( 5 and I I = PHYVV DVA; 6 and 12 = coat protein of BGYMV DN.4).
Primer Set 1 2 3 4 s 6 7 8 ~ I O I I I ~ I ~ I ~ I ~ I O I ~ 1 : 3 1 9 2 0
Fig 3. Exanlples the iipplication of the b~~gomc~virus-specific :PCR primer sets fo:: deliection of different torr~ato-infecting begomcviri~ses in gl:m~plasml of' a tomato breeding program in Guaternala (]Me-jia et al., 2004). L.anes :I a:nd 20 = 100-bp molec:ula.r nlarlcer; lanes 2-1 8 = to1nat.o samples from hybrids ancl breeding 1i;les; lanies in different gels have the :same order for plant sam-plels; lanes 2, 3, 4 --= three dif'fexnt Mi32 plants, lanlss :5, ti, 7 = three XA.175 plants, lanes 8, ' 2 , 10 .= three X A 1 56 plants, lanes 1 I, 12, 13 = tliree XA 188 plants, lane 14 = Tan,go, ;ane 1 5 =- Elios, lalie 16 := Miiriria, lane 1'7 = Silve:rado, lane 18 = water: lane 19 = positive control for each bego~lio~iir~is-specific pi:inier set. Rows are tlie agarose gels for the: respective l)~:go:n~o.vir~~s-spet:ifi~; primer set.
